ID: 939028917

View in Genome Browser
Species Human (GRCh38)
Location 2:137047058-137047080
Sequence GGTCCTATAGGACCACAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939028913_939028917 17 Left 939028913 2:137047018-137047040 CCAAAGTGGTAGAAATTTGAATT No data
Right 939028917 2:137047058-137047080 GGTCCTATAGGACCACAATAGGG No data
939028912_939028917 18 Left 939028912 2:137047017-137047039 CCCAAAGTGGTAGAAATTTGAAT No data
Right 939028917 2:137047058-137047080 GGTCCTATAGGACCACAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939028917 Original CRISPR GGTCCTATAGGACCACAATA GGG Intronic
No off target data available for this crispr