ID: 939034216

View in Genome Browser
Species Human (GRCh38)
Location 2:137111712-137111734
Sequence CTGGCTAAACAGAATAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939034216_939034221 25 Left 939034216 2:137111712-137111734 CCTTGTTTATTCTGTTTAGCCAG No data
Right 939034221 2:137111760-137111782 CACACTCTCACGTTGGTAAGGGG No data
939034216_939034218 18 Left 939034216 2:137111712-137111734 CCTTGTTTATTCTGTTTAGCCAG No data
Right 939034218 2:137111753-137111775 ACTGATTCACACTCTCACGTTGG No data
939034216_939034220 24 Left 939034216 2:137111712-137111734 CCTTGTTTATTCTGTTTAGCCAG No data
Right 939034220 2:137111759-137111781 TCACACTCTCACGTTGGTAAGGG No data
939034216_939034219 23 Left 939034216 2:137111712-137111734 CCTTGTTTATTCTGTTTAGCCAG No data
Right 939034219 2:137111758-137111780 TTCACACTCTCACGTTGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939034216 Original CRISPR CTGGCTAAACAGAATAAACA AGG (reversed) Intronic
No off target data available for this crispr