ID: 939034564

View in Genome Browser
Species Human (GRCh38)
Location 2:137115263-137115285
Sequence GCCCTCAGTGCGGCAGCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 251}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939034564_939034571 4 Left 939034564 2:137115263-137115285 CCAGCAGCTGCCGCACTGAGGGC 0: 1
1: 0
2: 0
3: 32
4: 251
Right 939034571 2:137115290-137115312 GAAGGTAGGCAGCCAGTTCCGGG 0: 1
1: 0
2: 1
3: 19
4: 208
939034564_939034568 -10 Left 939034564 2:137115263-137115285 CCAGCAGCTGCCGCACTGAGGGC 0: 1
1: 0
2: 0
3: 32
4: 251
Right 939034568 2:137115276-137115298 CACTGAGGGCCAAGGAAGGTAGG 0: 1
1: 0
2: 6
3: 54
4: 334
939034564_939034576 27 Left 939034564 2:137115263-137115285 CCAGCAGCTGCCGCACTGAGGGC 0: 1
1: 0
2: 0
3: 32
4: 251
Right 939034576 2:137115313-137115335 ACAGATGGTGCACTGCTGGTTGG 0: 1
1: 0
2: 0
3: 12
4: 168
939034564_939034572 12 Left 939034564 2:137115263-137115285 CCAGCAGCTGCCGCACTGAGGGC 0: 1
1: 0
2: 0
3: 32
4: 251
Right 939034572 2:137115298-137115320 GCAGCCAGTTCCGGGACAGATGG 0: 1
1: 0
2: 0
3: 7
4: 121
939034564_939034575 23 Left 939034564 2:137115263-137115285 CCAGCAGCTGCCGCACTGAGGGC 0: 1
1: 0
2: 0
3: 32
4: 251
Right 939034575 2:137115309-137115331 CGGGACAGATGGTGCACTGCTGG 0: 1
1: 0
2: 1
3: 5
4: 103
939034564_939034570 3 Left 939034564 2:137115263-137115285 CCAGCAGCTGCCGCACTGAGGGC 0: 1
1: 0
2: 0
3: 32
4: 251
Right 939034570 2:137115289-137115311 GGAAGGTAGGCAGCCAGTTCCGG 0: 1
1: 0
2: 1
3: 18
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939034564 Original CRISPR GCCCTCAGTGCGGCAGCTGC TGG (reversed) Exonic
904616637 1:31753605-31753627 GCTCTCAGTCTGGCAGCTGCAGG + Intronic
905269032 1:36774654-36774676 GCCCTCAGTGCTTCACCTGGGGG + Intergenic
906510447 1:46407668-46407690 GTCCCCAGTGAGGCAGGTGCTGG + Intronic
907113568 1:51949424-51949446 GCCCTCAGGGCTGCAACTGAGGG + Intronic
907158954 1:52357684-52357706 CCCTTCAGTGCGGGAGCAGCTGG - Exonic
907931043 1:59000476-59000498 GCCCTCACTGGGGCAGCTGGAGG - Intergenic
908205330 1:61842250-61842272 TGCCTTAGTGAGGCAGCTGCAGG + Intronic
908303314 1:62784138-62784160 GACCTCAGCGCCGCAGCTACAGG - Exonic
910337793 1:86154771-86154793 GCCCTCGGGGCAGGAGCTGCAGG + Intronic
914263945 1:146021698-146021720 GACCTCAGTGAGACAGCAGCCGG - Exonic
914950670 1:152110834-152110856 GCCCCCATTGCGGGAGCAGCGGG - Exonic
915789121 1:158648588-158648610 GCCCTCAGTGCTGCAGACCCTGG - Exonic
915914942 1:159935234-159935256 GCCATTAGAGTGGCAGCTGCAGG - Intronic
916717972 1:167461067-167461089 GTCCCCAGCGTGGCAGCTGCAGG - Intronic
917691734 1:177476910-177476932 TCCCTGAGTCCTGCAGCTGCTGG - Intergenic
918066489 1:181105288-181105310 GACCTCACTGGGGCAGCCGCGGG - Intergenic
920044528 1:203124815-203124837 GCCCACAGTGGGGAGGCTGCAGG + Intronic
920250953 1:204622169-204622191 GCACTGAATGCTGCAGCTGCAGG + Exonic
922101000 1:222476753-222476775 GTCCACAGTGAGGCAGATGCTGG + Intergenic
922251863 1:223856575-223856597 GCCCTCACTGGGGCAGCTGGAGG + Intergenic
922733617 1:227967919-227967941 GTCCACAGTGAGGCAGATGCTGG - Intergenic
923328461 1:232900867-232900889 GACCTCAGGGAGGCAGCTCCAGG - Intergenic
923744263 1:236686312-236686334 GGCCTCTGGGCGGCGGCTGCAGG + Intergenic
924343927 1:243056870-243056892 GTCCACAGTGAGGCAGATGCTGG + Intergenic
924830481 1:247588857-247588879 GCCCACAGAAGGGCAGCTGCAGG - Exonic
1063639767 10:7818333-7818355 GCGCCCAGGGCGGCAGGTGCTGG - Intergenic
1066732404 10:38448193-38448215 GTCCACAGTGAGGCAGATGCTGG - Intergenic
1067069506 10:43121534-43121556 TCCTTCAGTGTGGTAGCTGCTGG + Intronic
1068788401 10:61001589-61001611 CCCCGCAGGGCGGCGGCTGCCGG - Intergenic
1072474417 10:95745985-95746007 GGCCTCAGTCCCACAGCTGCTGG + Intronic
1072738723 10:97896780-97896802 GCCCTCAGTGTGGCAGGGACAGG + Intronic
1072781098 10:98252485-98252507 GCTGTCAGTGCGGCAGCAACAGG + Intronic
1073124268 10:101140090-101140112 GCCCTCAGCCCGGCAGCTCTCGG + Intergenic
1073181773 10:101587915-101587937 GTGCTCAGCGCCGCAGCTGCGGG + Exonic
1075940678 10:126388154-126388176 GCCTTCAGTGCAGCAGCTCTCGG + Exonic
1076109523 10:127850185-127850207 GTACTGAGTGGGGCAGCTGCTGG - Intergenic
1076889993 10:133278741-133278763 GCTCTCAGTGAGGCAGCCCCGGG + Exonic
1077069665 11:662865-662887 GCCCTCAGCACGGCAGCAGGGGG + Intronic
1077100670 11:820967-820989 GCCCATAGTGCAGCAGGTGCTGG + Intronic
1077309660 11:1882714-1882736 CCCCTCTGTGTGGCTGCTGCTGG + Intronic
1077369280 11:2174001-2174023 TCCCTCGGTGAGGCAGCTCCAGG + Intergenic
1080321113 11:31010355-31010377 GTCCTCAGTCATGCAGCTGCAGG - Intronic
1081507611 11:43734549-43734571 GCCCTCACTGGGGCAGCTGGAGG - Intronic
1084493557 11:69491028-69491050 GCCTGCTGTGCGCCAGCTGCTGG + Intergenic
1084557330 11:69882888-69882910 GATTTCAGTGCAGCAGCTGCGGG - Intergenic
1084747635 11:71183405-71183427 GGCCACAGGGCTGCAGCTGCTGG + Intronic
1086701193 11:89901847-89901869 GCCCTGACTGCAGCAGGTGCTGG + Intergenic
1086704974 11:89942680-89942702 GCCCTGACTGCAGCAGGTGCTGG - Intergenic
1088821304 11:113460185-113460207 TCCCTCAGTGGGGCTGCTCCAGG + Intronic
1089257612 11:117202063-117202085 GCCCTCAGGGTGGCAGTTGCTGG + Exonic
1089797784 11:120996910-120996932 GCTCTCAGTACAGCAGGTGCTGG + Intergenic
1091121663 11:133062908-133062930 GTCCCCAGCGCTGCAGCTGCCGG - Intronic
1091305142 11:134531801-134531823 GCCCTGAGTGAGGCCGCTGTAGG - Intergenic
1092720018 12:11432278-11432300 GCTCTCAGTGTGGGAGATGCTGG - Intronic
1096494210 12:52029959-52029981 GCCCTCAGGGCGGTGGCTGCTGG + Intronic
1103725464 12:122995475-122995497 GTCCTCAGTGCCGTTGCTGCGGG + Exonic
1104128428 12:125869578-125869600 GCTTTCAGTGAGCCAGCTGCAGG + Intergenic
1105292580 13:19062200-19062222 GCCCCCAGTGTGGCAGTGGCTGG + Intergenic
1105896841 13:24723826-24723848 TCCCTCCGTGGGGCAGGTGCTGG + Intergenic
1107147166 13:37071053-37071075 GCTCTCAGTGAGGCTGCAGCTGG - Intergenic
1107820550 13:44281823-44281845 GCACTCAGTGAGGCAGATCCAGG - Intergenic
1108245072 13:48505895-48505917 GCCCACAGTTCTGCAGCAGCTGG - Intronic
1108541679 13:51452302-51452324 GACCTGACTGCGGGAGCTGCCGG - Intronic
1108740283 13:53330569-53330591 GCCCTCAGTGTGGAAGTTGTCGG + Intergenic
1113770199 13:112903376-112903398 GCCCTCAGGGCAGCAGCCGTGGG - Intronic
1113879326 13:113614809-113614831 GCCGTCAGGGCGGAACCTGCAGG + Intronic
1114618541 14:24081490-24081512 GCCCGCAGCCCCGCAGCTGCCGG + Exonic
1117478981 14:56124655-56124677 GCTGTCAGTGCTGCAGCAGCAGG - Intronic
1122291244 14:100681537-100681559 GCCCTCAGAGTGGCAGCTTTAGG + Intergenic
1122786943 14:104168262-104168284 GCCCTCAGTGGTGCAGTTGCTGG + Intronic
1123079881 14:105686893-105686915 GCCCTGAGTGCGGGCTCTGCGGG + Intergenic
1202939897 14_KI270725v1_random:136708-136730 GCCCTCAGAGCCGCAGCACCGGG + Intergenic
1124881230 15:33644654-33644676 GCCCTCAGAGCTGCAGTTGCAGG + Intronic
1125729703 15:41886219-41886241 GCCCGCCATGCGGCAGCTACTGG - Exonic
1126729553 15:51668762-51668784 GCAATGAATGCGGCAGCTGCTGG + Intergenic
1127323687 15:57872846-57872868 GGCCTCAGTTCAGCAGATGCAGG + Intergenic
1128558292 15:68646524-68646546 TCCATCAGAGGGGCAGCTGCAGG + Intronic
1128571817 15:68739118-68739140 GTCCTGAGTGCGGGAGCTTCTGG - Intergenic
1129014223 15:72451457-72451479 GGCCTCACTGGGGCAGCTGGAGG - Intergenic
1129788250 15:78323216-78323238 GCCCTTTGTGCGGCACGTGCAGG - Intergenic
1132709273 16:1259257-1259279 ACCCTCAGTGCGGCCACGGCAGG - Intergenic
1134207932 16:12252836-12252858 GCCCACAGTGAGGGAGCAGCTGG + Intronic
1135395218 16:22126235-22126257 GCACTCCCTGCGGCTGCTGCTGG + Exonic
1136699216 16:32116534-32116556 GCCCTCAGAGCCGCGGCGGCGGG - Intergenic
1136768437 16:32811400-32811422 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1136799707 16:33059705-33059727 GCCCTCAGAGCCGCGGCGGCGGG - Intergenic
1136902137 16:34050969-34050991 GCCCTCAGAGCCGCGGCGGCTGG - Intergenic
1137966122 16:52935619-52935641 GCCCTCACTGGGGCAGCTGGAGG - Intergenic
1138351681 16:56349308-56349330 GCTCTCTGTTAGGCAGCTGCAGG + Intronic
1139650072 16:68357800-68357822 GGCCTCAGTGCTGCACCAGCTGG + Exonic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141331736 16:83117298-83117320 AGCTTCAGTGTGGCAGCTGCTGG - Intronic
1141448534 16:84080548-84080570 GACCTGAGGGTGGCAGCTGCGGG - Intronic
1141613359 16:85196512-85196534 GCCCTCAGTGTGGCTGGTACTGG + Intergenic
1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG + Intronic
1142200535 16:88759219-88759241 GAGCTCACAGCGGCAGCTGCAGG + Intronic
1142410239 16:89912338-89912360 CCCCACGGTGCTGCAGCTGCAGG + Intronic
1203070829 16_KI270728v1_random:1073416-1073438 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1143241519 17:5447008-5447030 CCCCTCAGTGCGGACGCTGCTGG - Intronic
1143434580 17:6914218-6914240 GCCGTGAGTGCGGAAGCCGCGGG + Intronic
1143614103 17:8039454-8039476 GCCCCCAGTGCTGCCCCTGCTGG + Exonic
1144727127 17:17507550-17507572 GCCCACAGTGGGGTCGCTGCTGG - Intronic
1145265255 17:21376826-21376848 GCAGCCAGCGCGGCAGCTGCCGG + Exonic
1145327704 17:21844354-21844376 GCCCTCAGAGCGGCGGCGGCGGG - Intergenic
1145694523 17:26775729-26775751 GCCCTCAGTGCCGCGGCGGCGGG - Intergenic
1145921660 17:28614350-28614372 ACCCTCAGAGTGGCAGCTGCAGG + Intergenic
1146590954 17:34127638-34127660 TCCCTCAGTGGGGCAGCTGGGGG + Intronic
1146887987 17:36485203-36485225 GTCCTCAGTGCTGAAGCTGCTGG - Intergenic
1147490814 17:40864246-40864268 GCCCTCGGTTTGGCAGCTGTAGG - Intronic
1147632634 17:41941900-41941922 GCCCACTGTGTGGCAGATGCTGG - Intronic
1147984909 17:44300314-44300336 TCCCTTAGTGTGGCAGATGCTGG - Intergenic
1148326923 17:46788781-46788803 GCACTCAGTGGGGCTGCTGAGGG - Intronic
1148386180 17:47236812-47236834 GCTCTCTGTGAGGCTGCTGCTGG + Intergenic
1148670278 17:49404988-49405010 GCCCTCACTGGGGCAGCTGGAGG + Exonic
1148846448 17:50532802-50532824 CCCCTCAGAGGGGCAGCGGCAGG - Exonic
1150832913 17:68540116-68540138 GCCATCAGTGAAGCAGCCGCAGG + Intronic
1151253142 17:72853476-72853498 GCTCTCTGTGCGGTATCTGCAGG - Intronic
1151820514 17:76494319-76494341 GCCCAATGTGCAGCAGCTGCTGG + Intronic
1203192344 17_KI270729v1_random:200593-200615 GCCCTCAGAGCAGCGGCGGCGGG - Intergenic
1203201709 17_KI270730v1_random:30-52 GCCCTCAGAGCAGCGGCGGCGGG - Intergenic
1154518342 18:15197903-15197925 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1156887849 18:42156347-42156369 TCCCTAAGTGTGGCAGCTGAAGG - Intergenic
1156900928 18:42299516-42299538 GCTCTCAGTGCAATAGCTGCTGG - Intergenic
1157359466 18:46964363-46964385 GCGCGCAGTGGGGAAGCTGCAGG - Exonic
1157361060 18:47023882-47023904 GCGCGCAGTGGGGAAGCTGCAGG - Exonic
1157362050 18:47029797-47029819 GCGCGCAGTGGGGAAGCTGCAGG - Exonic
1157621013 18:49017526-49017548 GCCCACAGGGCGGCATCTGTGGG - Intergenic
1158954451 18:62524710-62524732 GCGCTCGGTGCGGGAGCCGCCGG + Intronic
1160722885 19:604965-604987 GCCCCCACTGCGGGAGCTCCTGG - Intronic
1160787359 19:907294-907316 GGCCTCAGGGAGGCAGCTTCAGG - Intronic
1160897560 19:1409792-1409814 GCCCTCTCTGCGGCAGATGGCGG + Intronic
1161294447 19:3512625-3512647 GCCCTCAGCCCTGCAGCTCCAGG - Intronic
1162113302 19:8413149-8413171 CCCCGCTGTGCCGCAGCTGCTGG - Intronic
1163149490 19:15402549-15402571 GCTCTGAGTGCTGCAGCTGTTGG + Intronic
1165309734 19:35022878-35022900 CCCCTCACTGCTGCTGCTGCAGG + Exonic
1165319529 19:35076769-35076791 GCCCACAGTGTGGTGGCTGCAGG - Intergenic
1165976582 19:39681665-39681687 GCTCACAGTGCGGCCACTGCAGG - Intergenic
1165982263 19:39734817-39734839 GCCCCCAGTGCAGCTGCTGTAGG + Intronic
1166108950 19:40611285-40611307 GCCCACAGGGCGGCGGCTCCTGG - Exonic
1166384890 19:42375499-42375521 GCCCGCAGTGCGCCAAGTGCCGG + Exonic
1166893072 19:46006502-46006524 GCCCTCCGTGTGGCAGTGGCGGG + Intronic
1167133133 19:47600578-47600600 GTCCTCAGCGCGGCAAGTGCCGG - Intergenic
1168482656 19:56734746-56734768 TCCCTCAGTCCTCCAGCTGCAGG - Intergenic
925185399 2:1843212-1843234 CCTCACAGTGCGGCCGCTGCAGG + Intronic
926212024 2:10878429-10878451 GCCCTCACTGTGGAAGGTGCTGG + Intergenic
926239229 2:11072151-11072173 CCCCTTAGAGCGGGAGCTGCCGG - Intergenic
929664235 2:43821521-43821543 GCCCTCACTGCCGCAGATGCTGG + Intronic
932417580 2:71583234-71583256 CCCCTCAGAGCAGCAGGTGCTGG - Intronic
934153097 2:89168505-89168527 ACCCACAGTGCTGCAGGTGCAGG - Intergenic
934214143 2:90013426-90013448 ACCCACAGTGCTGCAGGTGCAGG + Intergenic
934738435 2:96702241-96702263 GCCCTCACTGAGGCTGCAGCTGG + Intergenic
934843756 2:97648090-97648112 GTGCTCAGTGTGCCAGCTGCTGG - Exonic
937972324 2:127560338-127560360 TGCCTCATTGCGGCAGTTGCCGG + Intronic
938186110 2:129233383-129233405 GCTCCCAGTGTGGCAGCAGCTGG - Intergenic
939034564 2:137115263-137115285 GCCCTCAGTGCGGCAGCTGCTGG - Exonic
940485025 2:154287407-154287429 GCCCTCACTGGGGCAGCTGGAGG - Intronic
941934748 2:170973926-170973948 GCGCCCAGTGCGGGAGGTGCGGG + Intergenic
947719847 2:232363695-232363717 GCCTGGAGTGAGGCAGCTGCAGG - Intergenic
947736072 2:232456208-232456230 GCCCTGGGTGCTGCTGCTGCTGG + Exonic
948463502 2:238141441-238141463 GCCCTGCGTGCAGCAACTGCTGG + Exonic
1170983295 20:21235852-21235874 GCCATCAGAGCATCAGCTGCAGG - Intronic
1171288832 20:23967891-23967913 GCACTCAGTGAGGCAGCTGTGGG + Intergenic
1175217863 20:57400927-57400949 GCCCTCTGTACGGCCGCTGCTGG - Intronic
1176583293 21:8550377-8550399 GCCCTCAGAGCCGCAGCACCAGG - Intergenic
1176876106 21:14130767-14130789 GACCTCAGTCCCACAGCTGCTGG - Intronic
1177369379 21:20181816-20181838 CCCCTCAGTGCTACAGTTGCTGG - Intergenic
1178196257 21:30348270-30348292 GCCCAGGGAGCGGCAGCTGCTGG + Intronic
1178198120 21:30371881-30371903 GCCCAGGGAGCGGCAGCTGCTGG + Exonic
1178200387 21:30396397-30396419 GCCCAGGGAGCGGCAGCTGCTGG - Exonic
1178203093 21:30430541-30430563 GCCCTGGGAGCGACAGCTGCTGG - Exonic
1178488849 21:33035266-33035288 GCCCAGAGTGCAGCTGCTGCTGG + Intergenic
1179991318 21:44949507-44949529 ACCCTCTGTGCAGCAGCAGCAGG + Intronic
1180032912 21:45224488-45224510 GCCCTGGGTGGGGCAGCTGTGGG + Exonic
1180159890 21:45994291-45994313 ACCCCCAGTGCGTGAGCTGCTGG - Intronic
1180181448 21:46120320-46120342 GTGCTCAGAGCGGCAGCTACAGG + Intronic
1180266103 22:10527307-10527329 GCCCTCAGAGCCGCAGCACCAGG - Intergenic
1182288367 22:29260814-29260836 ACCCTCAGAGCGACGGCTGCAGG - Exonic
1182302215 22:29343323-29343345 GCCGTCAGCACGGCTGCTGCTGG - Intronic
1182623506 22:31630444-31630466 GCCTGCAGTGAGGCGGCTGCAGG - Intronic
1183443675 22:37838584-37838606 GGTGTCAGTGCAGCAGCTGCTGG - Exonic
1183702670 22:39458562-39458584 CCCCTCAGAGCTGCAGCTCCTGG - Intronic
1183818347 22:40322951-40322973 ACCCCAAGTGCGCCAGCTGCGGG + Exonic
1184797293 22:46739538-46739560 GGCCTCAGAGCGGCAGCTGAGGG - Intergenic
1185279270 22:49962977-49962999 GCCCTCAGAGCGGCCGTCGCTGG + Exonic
1185296683 22:50058242-50058264 ACCCCCGGTGCGGCGGCTGCTGG + Intergenic
1203289159 22_KI270735v1_random:17428-17450 GCCCTCAGAGCTGCGGCGGCAGG + Intergenic
950101185 3:10357922-10357944 GAACTCAGTGCTGGAGCTGCCGG - Intronic
950386352 3:12663688-12663710 GCCCTCTGCCCGGCAGCCGCGGG + Intronic
953705693 3:45228191-45228213 GTCCTCAGGACGGCACCTGCTGG - Intergenic
959369198 3:105502517-105502539 GCCATCAGCCAGGCAGCTGCAGG + Intronic
960636801 3:119792535-119792557 GCCCTCACTGGGGCAGCTGGAGG - Intronic
961662534 3:128477325-128477347 GCCCTCACTGTGGCAACAGCTGG + Intergenic
962738860 3:138348656-138348678 GCCGTCAGTCCGGCGGCCGCGGG + Intronic
962859833 3:139389473-139389495 GCCCTCAGTCCAGAAGCTCCAGG + Intronic
963071402 3:141308352-141308374 GCCCTCAGTGCCTCAGCTTTAGG + Intergenic
965397842 3:168181985-168182007 GGCATCAGTGAGGCAGCTCCAGG + Intergenic
968538515 4:1150287-1150309 GCCCACCTTGCAGCAGCTGCGGG - Intergenic
968864227 4:3197546-3197568 GCCCCCGGGGTGGCAGCTGCTGG - Intronic
969441521 4:7219865-7219887 TCTCACAGTGCGGCTGCTGCGGG - Intronic
969488944 4:7487787-7487809 GCCCTCGGTACCGTAGCTGCTGG - Intronic
969670461 4:8587345-8587367 GCCCTCAGTGTGTCTGCTGCAGG - Exonic
969716863 4:8871967-8871989 GCCCCGAGCGCGGCCGCTGCCGG + Intergenic
971279992 4:25234577-25234599 GCCCGCGGTGCGGCTGCGGCTGG - Intronic
973055345 4:45650815-45650837 GCACTCAGGGCGGCAGAGGCAGG + Intergenic
979258792 4:118630818-118630840 GTCCACAGTGAGGCAGATGCTGG - Intergenic
979329557 4:119409738-119409760 GTCCACAGTGAGGCAGATGCTGG + Intergenic
980127340 4:128786691-128786713 CCCCTCAGTGCTGAAGCCGCAGG + Intergenic
983379999 4:166980648-166980670 GCCCACCCTGCTGCAGCTGCTGG - Intronic
983685141 4:170399517-170399539 ACCCTCAGTGCTGCATCTCCAGG - Intergenic
984616881 4:181908305-181908327 GTCCTCAGTCTGGCAGCTGAAGG + Intergenic
984709720 4:182875094-182875116 TCCCTCACTCCGGCAGATGCTGG - Intergenic
986608960 5:9547725-9547747 GCCTGCTGTGTGGCAGCTGCAGG + Intergenic
986731212 5:10636226-10636248 GCCCCCACTGTCGCAGCTGCAGG - Intronic
987303376 5:16616851-16616873 CCCCGCAGAGCGGCAGCAGCAGG - Exonic
991302758 5:65145080-65145102 GCACACAGCGGGGCAGCTGCTGG - Intergenic
992021638 5:72630535-72630557 GGCCACAGTGTGGCACCTGCCGG + Intergenic
997387852 5:133487753-133487775 GAGCTCAGTGGGGCAGTTGCTGG - Intronic
997624052 5:135319699-135319721 GCCCACAGTGGGGCAGATGCAGG + Intronic
1001770946 5:174295399-174295421 GGCCTCAGTGTGGAAGGTGCCGG + Intergenic
1002299567 5:178249459-178249481 GCCCCCAGAGGGGCAGCTCCAGG - Intronic
1002567869 5:180122230-180122252 TCACTCGGTGCTGCAGCTGCTGG + Intronic
1003101515 6:3179864-3179886 CCCCTCACAGCGGCTGCTGCAGG - Intergenic
1004044654 6:12012323-12012345 GCCTTCAGCGTGGCGGCTGCTGG + Exonic
1006451577 6:34108712-34108734 GCCCACAGTGTGCCAGGTGCTGG + Intronic
1006794482 6:36722815-36722837 GCCCTCCCTGAGGAAGCTGCAGG + Intronic
1007073915 6:39054775-39054797 CCCCTAAATGCAGCAGCTGCTGG - Intronic
1008052700 6:46916022-46916044 GCGCACAGTGAGGCAGCTGCAGG - Intronic
1011795411 6:90947389-90947411 GGCCTCATTGCGGCGGCTTCCGG - Intergenic
1013270946 6:108545016-108545038 GGGCTCATTGCAGCAGCTGCTGG - Intergenic
1013417457 6:109937838-109937860 GACCTCATTGCAGCAGCTGAGGG - Intergenic
1014027675 6:116668577-116668599 GAGCTCAGTGTGGCAGCTGCTGG - Exonic
1016828949 6:148414602-148414624 TCCCTCACTGCTGCAGCTCCAGG - Intronic
1016937313 6:149456886-149456908 GCCCTCAGAGCAGCACGTGCTGG - Exonic
1017008181 6:150043342-150043364 GCCCTCACTGGGGCAGCTGGAGG - Intergenic
1018674620 6:166207982-166208004 GTCCTGAGTGCAGCAGCTGGGGG - Intergenic
1019171352 6:170134902-170134924 GCTCTCAGATCTGCAGCTGCTGG - Intergenic
1019825387 7:3280024-3280046 TCCTTCAGTGGGGCAGGTGCAGG + Intergenic
1021362027 7:19727153-19727175 CCCCTGAGTGCAGCAGCTGCTGG + Intronic
1022722803 7:32956569-32956591 GCTCACAGTGCGGCCGCTGATGG + Intergenic
1023541486 7:41271150-41271172 GCCCTCTCTGTGGCACCTGCAGG - Intergenic
1024613148 7:51084263-51084285 GCCCTAAGGTCTGCAGCTGCAGG - Intronic
1024649638 7:51392332-51392354 GTCCACAGTGAGGCAGATGCTGG + Intergenic
1025053718 7:55747662-55747684 GTCCACAGTGAGGCAGATGCTGG + Intergenic
1025131821 7:56378136-56378158 GTCCACAGTGAGGCAGATGCTGG + Intergenic
1025306719 7:57868139-57868161 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1025561962 7:62380612-62380634 GCCCTCAGAGCCGCGGCGGCGGG - Intergenic
1025615602 7:63113991-63114013 GCACTCATTGCAGCTGCTGCTGG + Intergenic
1025878381 7:65509137-65509159 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1025882728 7:65554951-65554973 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1025890715 7:65647652-65647674 GCCCTCAGAGCCGCGGCGGCGGG - Exonic
1026456898 7:70580568-70580590 GCCATGAGGGCTGCAGCTGCAGG + Intronic
1026980766 7:74525348-74525370 GCCCTCAGGGAGACAGCGGCAGG - Intronic
1029307053 7:99628003-99628025 GCACTCAGTGAGGCAGAGGCAGG + Intronic
1029701749 7:102251399-102251421 GAACTAAGTGCTGCAGCTGCAGG - Exonic
1030658073 7:112190326-112190348 GCCCTGAGAGAGGCAGCTGCAGG + Intronic
1032051095 7:128651567-128651589 GTCCACAGTGAGGCAGATGCTGG - Intergenic
1032708725 7:134444284-134444306 GGCCACAGTGTGGCAGCAGCAGG + Intronic
1035695238 8:1591078-1591100 GCACCCAGTTCTGCAGCTGCCGG - Intronic
1035875194 8:3181130-3181152 GACATTAGTGTGGCAGCTGCTGG - Exonic
1036562171 8:9906665-9906687 GACATCACTGCGGCGGCTGCCGG + Intergenic
1044340416 8:91040745-91040767 GCCATGACTGCGGCAGCGGCGGG + Exonic
1045184502 8:99823415-99823437 GGCATTAGTGAGGCAGCTGCTGG + Intronic
1049453886 8:142677278-142677300 ACCCTCAGTGCGGCGGATGCTGG + Intronic
1049517537 8:143069219-143069241 GCCCTCACTGCGGAAGCGTCTGG - Intergenic
1049556184 8:143283400-143283422 GCCCTCAAAGCAGGAGCTGCTGG + Intergenic
1049735793 8:144203608-144203630 CCCCTCTGTGTGGAAGCTGCAGG - Intronic
1051910358 9:22148163-22148185 GCCCTCACTGCTACAACTGCAGG - Intergenic
1056763917 9:89433278-89433300 ACCCTCAGTCCGTCTGCTGCCGG - Intronic
1057139996 9:92720638-92720660 GATCTCAGAGCGGCAGCTGGAGG - Exonic
1060745563 9:126128652-126128674 GCCCTCAGAGACGCAGGTGCAGG + Intergenic
1061421118 9:130473320-130473342 GCCCTCAGTCATGCAGCTGGGGG + Intronic
1061863261 9:133478666-133478688 GCCCCCAGGGCGGCGGCTGGAGG + Intronic
1061904273 9:133688592-133688614 TCCCTCAGAGGAGCAGCTGCTGG + Intronic
1062044956 9:134420709-134420731 CCCCTCAGTGGTGCCGCTGCAGG - Intronic
1062623661 9:137433651-137433673 GCCCCGACTGAGGCAGCTGCTGG + Intronic
1062696621 9:137879011-137879033 TCCCTCCGTGCGGCGTCTGCCGG + Intronic
1188729628 X:33630875-33630897 GCTCTCATTGCTGCAGCTGGAGG + Intergenic
1190911538 X:54776079-54776101 GCCCACCGTGCCTCAGCTGCTGG - Intronic
1190929432 X:54935151-54935173 GCTCTCAGTGCTGCCCCTGCAGG - Intronic
1192204230 X:69085681-69085703 GCCCTAACTGCTGAAGCTGCTGG + Intergenic
1192265628 X:69535734-69535756 GAGCTCAGAGAGGCAGCTGCAGG - Intergenic
1193042141 X:77015175-77015197 GGCAACAGTGCGGCAGCTGCTGG + Intergenic
1196734949 X:118975056-118975078 GCTCTCCGAGCGGCAGCAGCTGG + Exonic
1199698484 X:150360476-150360498 GCAGTCTGTGCGGCAGCTACTGG + Intergenic