ID: 939036874

View in Genome Browser
Species Human (GRCh38)
Location 2:137142927-137142949
Sequence CTGCATGAATAGATTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939036874_939036878 29 Left 939036874 2:137142927-137142949 CCTCCCTCAATCTATTCATGCAG No data
Right 939036878 2:137142979-137143001 GAACTATCCTTGAATGGTTTTGG No data
939036874_939036879 30 Left 939036874 2:137142927-137142949 CCTCCCTCAATCTATTCATGCAG No data
Right 939036879 2:137142980-137143002 AACTATCCTTGAATGGTTTTGGG No data
939036874_939036877 23 Left 939036874 2:137142927-137142949 CCTCCCTCAATCTATTCATGCAG No data
Right 939036877 2:137142973-137142995 AATGTTGAACTATCCTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939036874 Original CRISPR CTGCATGAATAGATTGAGGG AGG (reversed) Intronic
No off target data available for this crispr