ID: 939042704

View in Genome Browser
Species Human (GRCh38)
Location 2:137209917-137209939
Sequence GATACCAGTCAGATTCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939042704_939042712 18 Left 939042704 2:137209917-137209939 CCTGTTTGAATCTGACTGGTATC No data
Right 939042712 2:137209958-137209980 TGGGCCTACAAAGGGGTGCCTGG No data
939042704_939042705 -9 Left 939042704 2:137209917-137209939 CCTGTTTGAATCTGACTGGTATC No data
Right 939042705 2:137209931-137209953 ACTGGTATCCTTATAAAAAGAGG 0: 13
1: 193
2: 829
3: 1636
4: 2488
939042704_939042706 -2 Left 939042704 2:137209917-137209939 CCTGTTTGAATCTGACTGGTATC No data
Right 939042706 2:137209938-137209960 TCCTTATAAAAAGAGGAAGTTGG No data
939042704_939042708 -1 Left 939042704 2:137209917-137209939 CCTGTTTGAATCTGACTGGTATC No data
Right 939042708 2:137209939-137209961 CCTTATAAAAAGAGGAAGTTGGG No data
939042704_939042714 22 Left 939042704 2:137209917-137209939 CCTGTTTGAATCTGACTGGTATC No data
Right 939042714 2:137209962-137209984 CCTACAAAGGGGTGCCTGGAAGG No data
939042704_939042709 9 Left 939042704 2:137209917-137209939 CCTGTTTGAATCTGACTGGTATC No data
Right 939042709 2:137209949-137209971 AGAGGAAGTTGGGCCTACAAAGG No data
939042704_939042710 10 Left 939042704 2:137209917-137209939 CCTGTTTGAATCTGACTGGTATC No data
Right 939042710 2:137209950-137209972 GAGGAAGTTGGGCCTACAAAGGG No data
939042704_939042711 11 Left 939042704 2:137209917-137209939 CCTGTTTGAATCTGACTGGTATC No data
Right 939042711 2:137209951-137209973 AGGAAGTTGGGCCTACAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939042704 Original CRISPR GATACCAGTCAGATTCAAAC AGG (reversed) Intronic
No off target data available for this crispr