ID: 939047212

View in Genome Browser
Species Human (GRCh38)
Location 2:137264062-137264084
Sequence TAGGCAACTCACCTAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939047212_939047217 30 Left 939047212 2:137264062-137264084 CCAGCACCTAGGTGAGTTGCCTA No data
Right 939047217 2:137264115-137264137 AATGATGACAACACTGTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939047212 Original CRISPR TAGGCAACTCACCTAGGTGC TGG (reversed) Intronic
No off target data available for this crispr