ID: 939051973

View in Genome Browser
Species Human (GRCh38)
Location 2:137318264-137318286
Sequence TACTTCTTTATGCACAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939051973_939051980 14 Left 939051973 2:137318264-137318286 CCATCTCTGTGCATAAAGAAGTA No data
Right 939051980 2:137318301-137318323 TTTAACAACCACAGGATGATGGG No data
939051973_939051977 6 Left 939051973 2:137318264-137318286 CCATCTCTGTGCATAAAGAAGTA No data
Right 939051977 2:137318293-137318315 AGTCCAGGTTTAACAACCACAGG No data
939051973_939051974 -9 Left 939051973 2:137318264-137318286 CCATCTCTGTGCATAAAGAAGTA No data
Right 939051974 2:137318278-137318300 AAAGAAGTACCTCCTAGTCCAGG No data
939051973_939051979 13 Left 939051973 2:137318264-137318286 CCATCTCTGTGCATAAAGAAGTA No data
Right 939051979 2:137318300-137318322 GTTTAACAACCACAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939051973 Original CRISPR TACTTCTTTATGCACAGAGA TGG (reversed) Intronic
No off target data available for this crispr