ID: 939051974

View in Genome Browser
Species Human (GRCh38)
Location 2:137318278-137318300
Sequence AAAGAAGTACCTCCTAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939051973_939051974 -9 Left 939051973 2:137318264-137318286 CCATCTCTGTGCATAAAGAAGTA No data
Right 939051974 2:137318278-137318300 AAAGAAGTACCTCCTAGTCCAGG No data
939051971_939051974 30 Left 939051971 2:137318225-137318247 CCTGACTCTAGTTCTCTATGTTC No data
Right 939051974 2:137318278-137318300 AAAGAAGTACCTCCTAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939051974 Original CRISPR AAAGAAGTACCTCCTAGTCC AGG Intronic
No off target data available for this crispr