ID: 939051979

View in Genome Browser
Species Human (GRCh38)
Location 2:137318300-137318322
Sequence GTTTAACAACCACAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939051973_939051979 13 Left 939051973 2:137318264-137318286 CCATCTCTGTGCATAAAGAAGTA No data
Right 939051979 2:137318300-137318322 GTTTAACAACCACAGGATGATGG No data
939051975_939051979 -10 Left 939051975 2:137318287-137318309 CCTCCTAGTCCAGGTTTAACAAC No data
Right 939051979 2:137318300-137318322 GTTTAACAACCACAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939051979 Original CRISPR GTTTAACAACCACAGGATGA TGG Intronic
No off target data available for this crispr