ID: 939052473

View in Genome Browser
Species Human (GRCh38)
Location 2:137324548-137324570
Sequence CAAAATGCTTATAGTTAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939052468_939052473 -4 Left 939052468 2:137324529-137324551 CCTCTGTAGTTCCTAACCTCAAA No data
Right 939052473 2:137324548-137324570 CAAAATGCTTATAGTTAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939052473 Original CRISPR CAAAATGCTTATAGTTAAAG GGG Intronic
No off target data available for this crispr