ID: 939064387

View in Genome Browser
Species Human (GRCh38)
Location 2:137465122-137465144
Sequence TAGAAAAAAGGATTAATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939064387_939064391 17 Left 939064387 2:137465122-137465144 CCATATATTAATCCTTTTTTCTA No data
Right 939064391 2:137465162-137465184 AGTTTTGTTTGTCTGAAACTAGG No data
939064387_939064393 30 Left 939064387 2:137465122-137465144 CCATATATTAATCCTTTTTTCTA No data
Right 939064393 2:137465175-137465197 TGAAACTAGGAGTAAGCAGGAGG No data
939064387_939064392 27 Left 939064387 2:137465122-137465144 CCATATATTAATCCTTTTTTCTA No data
Right 939064392 2:137465172-137465194 GTCTGAAACTAGGAGTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939064387 Original CRISPR TAGAAAAAAGGATTAATATA TGG (reversed) Intronic
No off target data available for this crispr