ID: 939064388

View in Genome Browser
Species Human (GRCh38)
Location 2:137465134-137465156
Sequence TGGTAGCAGTGGTAGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939064388_939064394 27 Left 939064388 2:137465134-137465156 CCTTTTTTCTACCACTGCTACCA No data
Right 939064394 2:137465184-137465206 GAGTAAGCAGGAGGCAGAGTAGG No data
939064388_939064392 15 Left 939064388 2:137465134-137465156 CCTTTTTTCTACCACTGCTACCA No data
Right 939064392 2:137465172-137465194 GTCTGAAACTAGGAGTAAGCAGG No data
939064388_939064391 5 Left 939064388 2:137465134-137465156 CCTTTTTTCTACCACTGCTACCA No data
Right 939064391 2:137465162-137465184 AGTTTTGTTTGTCTGAAACTAGG No data
939064388_939064395 28 Left 939064388 2:137465134-137465156 CCTTTTTTCTACCACTGCTACCA No data
Right 939064395 2:137465185-137465207 AGTAAGCAGGAGGCAGAGTAGGG No data
939064388_939064393 18 Left 939064388 2:137465134-137465156 CCTTTTTTCTACCACTGCTACCA No data
Right 939064393 2:137465175-137465197 TGAAACTAGGAGTAAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939064388 Original CRISPR TGGTAGCAGTGGTAGAAAAA AGG (reversed) Intronic
No off target data available for this crispr