ID: 939064389

View in Genome Browser
Species Human (GRCh38)
Location 2:137465145-137465167
Sequence AAAACTATACTTGGTAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939064389_939064393 7 Left 939064389 2:137465145-137465167 CCACTGCTACCAAGTATAGTTTT No data
Right 939064393 2:137465175-137465197 TGAAACTAGGAGTAAGCAGGAGG No data
939064389_939064399 27 Left 939064389 2:137465145-137465167 CCACTGCTACCAAGTATAGTTTT No data
Right 939064399 2:137465195-137465217 AGGCAGAGTAGGGTGGGACTGGG No data
939064389_939064394 16 Left 939064389 2:137465145-137465167 CCACTGCTACCAAGTATAGTTTT No data
Right 939064394 2:137465184-137465206 GAGTAAGCAGGAGGCAGAGTAGG No data
939064389_939064396 20 Left 939064389 2:137465145-137465167 CCACTGCTACCAAGTATAGTTTT No data
Right 939064396 2:137465188-137465210 AAGCAGGAGGCAGAGTAGGGTGG No data
939064389_939064392 4 Left 939064389 2:137465145-137465167 CCACTGCTACCAAGTATAGTTTT No data
Right 939064392 2:137465172-137465194 GTCTGAAACTAGGAGTAAGCAGG No data
939064389_939064391 -6 Left 939064389 2:137465145-137465167 CCACTGCTACCAAGTATAGTTTT No data
Right 939064391 2:137465162-137465184 AGTTTTGTTTGTCTGAAACTAGG No data
939064389_939064395 17 Left 939064389 2:137465145-137465167 CCACTGCTACCAAGTATAGTTTT No data
Right 939064395 2:137465185-137465207 AGTAAGCAGGAGGCAGAGTAGGG No data
939064389_939064398 26 Left 939064389 2:137465145-137465167 CCACTGCTACCAAGTATAGTTTT No data
Right 939064398 2:137465194-137465216 GAGGCAGAGTAGGGTGGGACTGG No data
939064389_939064397 21 Left 939064389 2:137465145-137465167 CCACTGCTACCAAGTATAGTTTT No data
Right 939064397 2:137465189-137465211 AGCAGGAGGCAGAGTAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939064389 Original CRISPR AAAACTATACTTGGTAGCAG TGG (reversed) Intronic
No off target data available for this crispr