ID: 939064392

View in Genome Browser
Species Human (GRCh38)
Location 2:137465172-137465194
Sequence GTCTGAAACTAGGAGTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939064390_939064392 -5 Left 939064390 2:137465154-137465176 CCAAGTATAGTTTTGTTTGTCTG No data
Right 939064392 2:137465172-137465194 GTCTGAAACTAGGAGTAAGCAGG No data
939064388_939064392 15 Left 939064388 2:137465134-137465156 CCTTTTTTCTACCACTGCTACCA No data
Right 939064392 2:137465172-137465194 GTCTGAAACTAGGAGTAAGCAGG No data
939064387_939064392 27 Left 939064387 2:137465122-137465144 CCATATATTAATCCTTTTTTCTA No data
Right 939064392 2:137465172-137465194 GTCTGAAACTAGGAGTAAGCAGG No data
939064389_939064392 4 Left 939064389 2:137465145-137465167 CCACTGCTACCAAGTATAGTTTT No data
Right 939064392 2:137465172-137465194 GTCTGAAACTAGGAGTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939064392 Original CRISPR GTCTGAAACTAGGAGTAAGC AGG Intronic
No off target data available for this crispr