ID: 939069230

View in Genome Browser
Species Human (GRCh38)
Location 2:137518912-137518934
Sequence TGCCCTTTCCATGATGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 885
Summary {0: 131, 1: 184, 2: 150, 3: 123, 4: 297}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939069230_939069240 10 Left 939069230 2:137518912-137518934 CCTCTTCCATCATGGAAAGGGCA 0: 131
1: 184
2: 150
3: 123
4: 297
Right 939069240 2:137518945-137518967 CTCACTGGAAAAGGGGAAAGGGG No data
939069230_939069241 14 Left 939069230 2:137518912-137518934 CCTCTTCCATCATGGAAAGGGCA 0: 131
1: 184
2: 150
3: 123
4: 297
Right 939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG No data
939069230_939069236 3 Left 939069230 2:137518912-137518934 CCTCTTCCATCATGGAAAGGGCA 0: 131
1: 184
2: 150
3: 123
4: 297
Right 939069236 2:137518938-137518960 GTTTGTCCTCACTGGAAAAGGGG No data
939069230_939069234 1 Left 939069230 2:137518912-137518934 CCTCTTCCATCATGGAAAGGGCA 0: 131
1: 184
2: 150
3: 123
4: 297
Right 939069234 2:137518936-137518958 AGGTTTGTCCTCACTGGAAAAGG No data
939069230_939069243 20 Left 939069230 2:137518912-137518934 CCTCTTCCATCATGGAAAGGGCA 0: 131
1: 184
2: 150
3: 123
4: 297
Right 939069243 2:137518955-137518977 AAGGGGAAAGGGGCTGGGCACGG No data
939069230_939069242 15 Left 939069230 2:137518912-137518934 CCTCTTCCATCATGGAAAGGGCA 0: 131
1: 184
2: 150
3: 123
4: 297
Right 939069242 2:137518950-137518972 TGGAAAAGGGGAAAGGGGCTGGG No data
939069230_939069239 9 Left 939069230 2:137518912-137518934 CCTCTTCCATCATGGAAAGGGCA 0: 131
1: 184
2: 150
3: 123
4: 297
Right 939069239 2:137518944-137518966 CCTCACTGGAAAAGGGGAAAGGG No data
939069230_939069235 2 Left 939069230 2:137518912-137518934 CCTCTTCCATCATGGAAAGGGCA 0: 131
1: 184
2: 150
3: 123
4: 297
Right 939069235 2:137518937-137518959 GGTTTGTCCTCACTGGAAAAGGG No data
939069230_939069237 8 Left 939069230 2:137518912-137518934 CCTCTTCCATCATGGAAAGGGCA 0: 131
1: 184
2: 150
3: 123
4: 297
Right 939069237 2:137518943-137518965 TCCTCACTGGAAAAGGGGAAAGG No data
939069230_939069244 23 Left 939069230 2:137518912-137518934 CCTCTTCCATCATGGAAAGGGCA 0: 131
1: 184
2: 150
3: 123
4: 297
Right 939069244 2:137518958-137518980 GGGAAAGGGGCTGGGCACGGTGG No data
939069230_939069233 -5 Left 939069230 2:137518912-137518934 CCTCTTCCATCATGGAAAGGGCA 0: 131
1: 184
2: 150
3: 123
4: 297
Right 939069233 2:137518930-137518952 GGGCAGAGGTTTGTCCTCACTGG 0: 134
1: 185
2: 109
3: 116
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939069230 Original CRISPR TGCCCTTTCCATGATGGAAG AGG (reversed) Intronic
900600970 1:3502512-3502534 TGCCCTTTCCCTGTGGGATGGGG + Intronic
900779941 1:4611564-4611586 TGCCCTTTCCCTAAAGGAGGAGG + Intergenic
901903766 1:12390623-12390645 TGCCCTTTCCATGATGGAAGAGG + Intronic
902070002 1:13726289-13726311 TGACCTTTCCATGCTGGACGGGG - Intronic
904045679 1:27606994-27607016 TGCCCTTTCCATGAGGTCTGGGG - Intergenic
904077671 1:27853675-27853697 TGCCCTGTCCAGGAGGGAGGTGG + Intergenic
904077925 1:27854246-27854268 TGCCCTGTCCAGGAGGGAGGTGG + Intergenic
904179293 1:28654604-28654626 TGCCCTTTCTGTGATGGAAGAGG + Intergenic
904255090 1:29249659-29249681 TGCCGTTTACATCCTGGAAGGGG + Intronic
904336088 1:29799041-29799063 TGTCCTTTCCGTGATGCAAGAGG - Intergenic
904369919 1:30041962-30041984 TGACCTTTCATTGATGGCAGTGG + Intergenic
905354225 1:37369835-37369857 TGCCCTTTCCATGATGGAAGAGG - Intergenic
905465384 1:38149156-38149178 TGCCCTTTCCATGATGGAAGAGG - Intergenic
905729680 1:40288385-40288407 TGCCCCTTCCATGAGGGAAAGGG + Intronic
905729681 1:40288387-40288409 AACCCTTTCCCTCATGGAAGGGG - Intronic
906050641 1:42868462-42868484 TGCCCTTTCCGTGATGGAAGAGG - Intergenic
906188196 1:43877809-43877831 TGCCCCTTCCCTGAAGGTAGAGG + Intronic
906448856 1:45926665-45926687 TGCGCTTTCCCTGCTGTAAGAGG - Intronic
906699930 1:47850432-47850454 TGCTCTTTCAAGGTTGGAAGAGG - Intronic
906879804 1:49577507-49577529 TGCTTTTTCCATGATGGAAGAGG - Intronic
906930770 1:50167472-50167494 TGCCCTTTCCGTGATGGAAGAGG + Intronic
907137569 1:52154245-52154267 TGGCCCATCCAAGATGGAAGAGG + Intronic
907253697 1:53161381-53161403 TGCCTTTTCCTTGAGGGAAGGGG + Intergenic
907597498 1:55733169-55733191 TTCCCTTTCCATGATGGAAGAGG - Intergenic
907780486 1:57561888-57561910 TGTCCTTTGTATAATGGAAGAGG - Intronic
908052468 1:60247764-60247786 TTCCCTTTCCATGATGGAAGAGG - Intergenic
908737540 1:67291866-67291888 TGCCCTTTGCATGACGGAAGAGG - Intergenic
908963046 1:69725277-69725299 TGCTCTTTCCATCTTGGAGGTGG + Intronic
909032513 1:70559365-70559387 TGTCCTTTCCATGGGGGAAGAGG - Intergenic
909032738 1:70561243-70561265 TGCCCTTTCCATGATGGAAGAGG + Intergenic
909278861 1:73723153-73723175 TGTCTCTTCCATGATGGACGTGG - Intergenic
909548800 1:76876145-76876167 TGCCTTTTCCATGATGGAAGAGG + Intronic
909577079 1:77186906-77186928 TGCCCTTTTCGTGATGGAAGAGG - Intronic
909781363 1:79551343-79551365 TGCCCCTTCCCTGATGGAGGTGG - Intergenic
909811094 1:79932382-79932404 TGCCCTTCCCATGACAGAAGAGG - Intergenic
909858769 1:80575993-80576015 TGCCTTTTCCATGTTGGAAGAGG + Intergenic
910003430 1:82364845-82364867 AGTCATTTCCATGATGAAAGAGG - Intergenic
910141679 1:84033079-84033101 TGCCTCTTCTATGATGAAAGTGG - Intergenic
910370790 1:86513184-86513206 TGCTCTTTCCATGATAAAAGAGG - Intergenic
910562047 1:88601021-88601043 AGCCCTTTCCATGATGAAAGAGG - Intergenic
910588370 1:88902773-88902795 TGCCCTTTCCATGATGGAAGAGG - Intergenic
910630366 1:89347317-89347339 TGCCCTCTTCATGATGGAAGAGG - Intergenic
910638850 1:89439020-89439042 TACCCTTTCCATGATAGAAGAGG + Intergenic
910830946 1:91462368-91462390 TGCCCTTTCCATGAAGGAAGAGG + Intergenic
910948362 1:92617761-92617783 TGCCCTTTCCATGATGGAAAAGG - Intronic
911109017 1:94163650-94163672 TTTCCTTTCCATGATGGAAGAGG + Intronic
911221457 1:95251881-95251903 TGGCCCTTCCATTAGGGAAGGGG + Intergenic
911257187 1:95646309-95646331 TTCCCTTTCCATGATGGAAGAGG + Intergenic
911738246 1:101360878-101360900 TGCCCTTTCCATGATGAGAGAGG + Intergenic
911883719 1:103271515-103271537 TGCTCTTTCCATGATGGAAGAGG - Intergenic
912050551 1:105523889-105523911 TGGCCTTTCCATGGTGAAAGAGG + Intergenic
912088099 1:106035292-106035314 TGCTCCTTCCATGATAGAAATGG - Intergenic
912212401 1:107569913-107569935 TGCCTTTTCCATGATGGAAGAGG - Intergenic
912251871 1:108020332-108020354 TGCCCTTCCCATGATGGAAGAGG + Intergenic
912733175 1:112127780-112127802 TGCTCTTTCCATGATGGAAGAGG + Intergenic
912943655 1:114067153-114067175 TGCCCTTTCCATGATGGAAGAGG + Intergenic
913039294 1:115007343-115007365 TGCTCTTTGCATGATGGAAGAGG + Intergenic
914965363 1:152252852-152252874 TGCCCTTTCCATGATGACAGAGG + Intergenic
915667526 1:157458620-157458642 TACCCTTTCCATGATGGAAGAGG + Intergenic
915703734 1:157823634-157823656 TACCGCTTCCATGATGGAAGTGG + Intergenic
915703735 1:157823636-157823658 GGCCACTTCCATCATGGAAGCGG - Intergenic
915709805 1:157884695-157884717 TGCTTTTTCCATGATGGAAGAGG - Intronic
915961645 1:160272011-160272033 TGCCTTTTCCAAAATGGAAAAGG + Intergenic
916106046 1:161433245-161433267 TGACTTTTCCATGATGGGAGAGG + Intergenic
916285481 1:163100572-163100594 TGCCCTTTCCATGATGGAAGAGG - Intergenic
916369987 1:164081158-164081180 TACCCCTTCCATGATGGAAGTGG - Intergenic
916381020 1:164210598-164210620 CCCTTTTTCCATGATGGAAGTGG - Intergenic
916862316 1:168819258-168819280 TGCCCTTACCCTGAGGTAAGCGG - Intergenic
917266106 1:173222591-173222613 TGTACTTTGCTTGATGGAAGAGG - Intergenic
917764688 1:178203064-178203086 TGCCCTTTCCATGATAGAAGAGG - Intronic
918774646 1:188611798-188611820 TGCCCTTTTCATGATGGAAGAGG - Intergenic
918783320 1:188731490-188731512 TGCCTTTTCCATGTTGGACGAGG + Intergenic
918815202 1:189172275-189172297 TGTCCTTTCCATGATGGAAGAGG - Intergenic
918857691 1:189779968-189779990 TTCTCTTTTCATGATAGAAGTGG - Intergenic
918958386 1:191238987-191239009 TGCCCTTTCCATGATAGAAGAGG - Intergenic
919000589 1:191826823-191826845 TGCCCTTTCCATGATGGAAGAGG + Intergenic
919124225 1:193376914-193376936 TGCCCTTTCCATGATGGAAAAGG + Intergenic
919318123 1:196000396-196000418 TGCCCTTTCCATGATGGAAGAGG - Intergenic
919330355 1:196162980-196163002 TTCCCTTTCCATGATGGAAGAGG - Intergenic
920197586 1:204239409-204239431 TGCCCTTTCCATGATGGAAGAGG - Intronic
922780904 1:228251549-228251571 TGCCCTTTCTATGATGGAAGAGG + Intronic
923253424 1:232198395-232198417 TGGCCTTTCCATGATGGAAGAGG + Intergenic
923426600 1:233876256-233876278 AGTCCCTTCCATGATGGAAGTGG - Intergenic
923926039 1:238628756-238628778 TGCCCTTTGCATGATGGAAGTGG + Intergenic
924368989 1:243327100-243327122 GGCCCTTTCCTTGGTGGAAATGG - Intronic
924840622 1:247706777-247706799 TGCCCTTTCCAAGATGGAAGAGG + Intergenic
924846993 1:247784091-247784113 TGCCATTTTCATGATGGAAGAGG + Intergenic
1063877492 10:10495377-10495399 TGGCCTTACCATGATGTATGTGG + Intergenic
1064517436 10:16166749-16166771 TGCCCTTTCCATGATAGAAGAGG + Intergenic
1064557130 10:16558937-16558959 TCCCCTTTCCCTTATGGATGGGG + Intergenic
1065704914 10:28463894-28463916 TGCCCCCTCCCTGATGGAAGAGG - Intergenic
1065722695 10:28641984-28642006 AGCCCTTGCCATCAAGGAAGGGG + Intergenic
1066166873 10:32798175-32798197 TGCCCTTTCCATGATAACAGAGG + Intronic
1066169588 10:32827367-32827389 TGCCCTTCCCATGATGGAAAAGG - Intronic
1066268046 10:33795413-33795435 TTCACTTTCCATCATGAAAGTGG - Intergenic
1066416073 10:35223249-35223271 TGTCCCTTCCAAGGTGGAAGAGG - Intergenic
1066957765 10:42189109-42189131 TCTCCTTTCCATGGTGGAAGAGG - Intergenic
1067026112 10:42845605-42845627 TGCCCGTTCCATGGTGGAAAAGG + Intergenic
1067125402 10:43511494-43511516 TGTCCATTCCATGATGGAAGAGG + Intergenic
1067333293 10:45341272-45341294 TGCCCTTTTCAGGATGGAAGAGG - Intergenic
1067750434 10:48968003-48968025 GTCCCTTTCCATGAGGGCAGGGG - Intronic
1067754202 10:48992665-48992687 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1068007519 10:51408527-51408549 TGCCCTTTCCTTGATGGAAGAGG + Intronic
1068303399 10:55175264-55175286 TAGCCTTTCCAGGATGGCAGTGG - Intronic
1068447351 10:57139647-57139669 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1068837065 10:61567327-61567349 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1069145904 10:64891478-64891500 TGCCCTTTACATGATGGATGAGG - Intergenic
1069790680 10:71018531-71018553 TGCCCCTTTCATAATGGAAGAGG + Intergenic
1070703130 10:78617911-78617933 TACCATTTTCATGATGCAAGTGG + Intergenic
1070815619 10:79321169-79321191 TGCCCTTCCCATGAGGGAAGGGG - Intergenic
1070855837 10:79607481-79607503 TGGCCTTTCCAGGAAGGCAGTGG + Intergenic
1070948810 10:80414370-80414392 GACCCTTTCCTTAATGGAAGGGG + Intronic
1071266925 10:83972951-83972973 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1071308658 10:84323105-84323127 TGTCCTTTACATGATGGAAGAGG - Intergenic
1071364337 10:84883470-84883492 TGCCCTTTACATGGTGGAAGAGG + Intergenic
1071378528 10:85034412-85034434 TGCTCTTTCCATGATGGAAGAGG - Intergenic
1071485190 10:86096466-86096488 TGCCACTTCTCTGATGGAAGTGG - Intronic
1071673765 10:87636373-87636395 TGCCCTGTCCATGGTGTAAGAGG + Intergenic
1071937838 10:90550330-90550352 TGCCCTTTTCGTGATGGAAGAGG - Intergenic
1071942633 10:90606722-90606744 TGCCCTTTCCATCATGGAAGAGG + Intergenic
1072209115 10:93230654-93230676 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1072360608 10:94655139-94655161 TGCCCTTTTCATGATGGAAGAGG - Intergenic
1072361943 10:94668219-94668241 TGCTCTTTCCATGATGAATGTGG + Intergenic
1073107148 10:101038729-101038751 TGCCTTGTCCATGGTGGATGTGG + Intronic
1073557503 10:104466946-104466968 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1073656530 10:105423439-105423461 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1073957605 10:108891127-108891149 TGCCTTTTCCATGATGGAACAGG + Intergenic
1074721159 10:116266413-116266435 TGGCCTTTGCAGGATGGAAAAGG - Intronic
1075606943 10:123818458-123818480 TGCCCTTTCCATGATGAAAGAGG - Intronic
1076772467 10:132673785-132673807 TGCCCTTCCCATGATGGAAGAGG + Intronic
1076927254 10:133498163-133498185 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1078195385 11:9132909-9132931 TGGCCTTTCCAGAATGGAAGGGG - Intronic
1078427584 11:11264587-11264609 AGCCCCTTCCCTGATGGAAAGGG + Intergenic
1078427586 11:11264589-11264611 TCCCCTTTCCATCAGGGAAGGGG - Intergenic
1080020018 11:27550630-27550652 TGCTCCTTCCATGGTAGAAGTGG + Intergenic
1080384790 11:31804911-31804933 TGCCATTTCGATGCTGGGAGTGG - Intronic
1080511409 11:32976576-32976598 TGACAGTTCCATGATGGAAGCGG - Exonic
1080790777 11:35520721-35520743 TGCCATTTCCATGATAAATGAGG - Intronic
1081065311 11:38533716-38533738 TGCCCTTTCTATGATGGAAGAGG + Intergenic
1081110675 11:39129767-39129789 TGTCCTTTCCATGATGGTAGAGG - Intergenic
1081378437 11:42386956-42386978 TGCCGTTTCCATGATGGAAGAGG - Intergenic
1081602993 11:44508214-44508236 TGGGCTTTCCATGAGGGCAGTGG - Intergenic
1081609214 11:44548912-44548934 TGCCTTTTCCATGATGGAAGAGG - Intergenic
1082920371 11:58485952-58485974 TGCCCCTTCCATGATTGAATTGG - Intergenic
1082929902 11:58591798-58591820 TGCCACTTCCATGATGGAAGTGG + Intronic
1082999805 11:59280898-59280920 TGCCCTTTTCTTAATGGAAGAGG - Intergenic
1083093281 11:60222149-60222171 TGCCCTTTCCGTGATGGAAGAGG - Intronic
1083134143 11:60655545-60655567 TGCCCTCTCCATGACAGAAATGG - Intergenic
1083196687 11:61092452-61092474 TGCACTTTCCATGACACAAGAGG - Intergenic
1083596008 11:63918510-63918532 TGCCCAATCCATGATTTAAGAGG - Intergenic
1083698233 11:64456880-64456902 TGCCCTTTCCAGGGTGGAAGGGG - Intergenic
1084356248 11:68640730-68640752 TGGCCTTTCCAGAATGAAAGAGG - Intergenic
1084734505 11:71095649-71095671 TGCCCTTTCTGGGATGGAGGGGG - Intronic
1084929500 11:72543320-72543342 TTCCCCTTCCAGGATAGAAGGGG + Intergenic
1085684819 11:78611893-78611915 GGCCATTTCCATCATGGAAGGGG + Intergenic
1085684820 11:78611895-78611917 TGCCCCTTCCATGATGGAAATGG - Intergenic
1085686108 11:78623214-78623236 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1085748477 11:79136601-79136623 TGCCTTTTCCATGATGGAAGAGG - Intronic
1086141482 11:83505172-83505194 TGCTCTTTCCGTGATGGAAGAGG + Intronic
1086278754 11:85161481-85161503 TGCCTTTTCCATGATGGAAGAGG - Intronic
1087347740 11:96992516-96992538 TGCACCTTCCATGGTGGAAGTGG - Intergenic
1087374163 11:97321573-97321595 TGTCCTTTCCATGATGGAAGAGG - Intergenic
1088097356 11:106116196-106116218 TGTCCTTTCCATGATAGAAGAGG - Intergenic
1088202869 11:107359226-107359248 TGCCCCTTCCAGGATGGAAGCGG - Intronic
1088264137 11:107973722-107973744 TGCCCCTTCCATGATGGAAAAGG + Intergenic
1088264138 11:107973724-107973746 GACCTTTTCCATCATGGAAGGGG - Intergenic
1088265572 11:107984629-107984651 TGCCCTTTCCGTGATGCAAGAGG - Intergenic
1088836805 11:113584409-113584431 TGCCCTTTCCATGATGGAAGTGG - Intergenic
1089059919 11:115618170-115618192 TGCCCATTCTATGAACGAAGAGG + Intergenic
1089806403 11:121094491-121094513 TGACCCTTCCAGGATGAAAGGGG + Intergenic
1089903764 11:122014640-122014662 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1090197123 11:124826293-124826315 TGCCCTTTCCACGATGGAAAAGG + Intergenic
1090966016 11:131598103-131598125 TGCCCTTTCCAGGCTGGAAGGGG + Intronic
1091051895 11:132379783-132379805 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1092012294 12:5124574-5124596 TGCCCCTTCCATGATGGAAGTGG + Intergenic
1092093433 12:5822663-5822685 TGCCCTTTCCATGATGGAAGAGG - Intronic
1092342444 12:7688245-7688267 TGCAGTTTTCATGATGGAATAGG - Intergenic
1092381696 12:8001952-8001974 TGCCTTTTCCATGATGGAACAGG - Intergenic
1092922402 12:13244491-13244513 TACCCCTTCCATGATGGAAATGG + Intergenic
1092922403 12:13244493-13244515 GACCATTTCCATCATGGAAGGGG - Intergenic
1093031713 12:14294906-14294928 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1093036496 12:14336705-14336727 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1093048788 12:14484045-14484067 TTCCCTTTCCATGATGGAAGAGG + Intronic
1093049523 12:14489943-14489965 TTCCCTTTCCATGATGGAAGAGG + Intronic
1093213181 12:16331772-16331794 TGCCTTTTCTGTGATGTAAGAGG + Intergenic
1093222225 12:16436120-16436142 TGCCTTTTTCCTGTTGGAAGAGG - Intronic
1093645864 12:21584687-21584709 TGCCCTTTCCATGATGGAAGAGG - Intronic
1093752828 12:22820081-22820103 TGCCCCTTTCATGCTGGAAGTGG - Intergenic
1093981459 12:25479770-25479792 TGCCCTTTTCATGATAGAAGAGG + Intronic
1094389640 12:29935195-29935217 TGCCCTTTCCGTGATGGAAGAGG + Intergenic
1095604000 12:44045368-44045390 AAACCTTTCCATGATGAAAGAGG - Intronic
1095738653 12:45585153-45585175 TGCCCTTTCCATGATGAAAGTGG - Intergenic
1095844236 12:46728946-46728968 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1096300871 12:50426128-50426150 TCCCCCTTCCCTGAGGGAAGAGG + Intronic
1096457310 12:51798419-51798441 TGCCCTTTCCATGATGGAAGAGG + Intronic
1096768441 12:53914249-53914271 TGCCTTCTGCATGATGGAGGGGG + Intergenic
1097077143 12:56403424-56403446 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1097437682 12:59571235-59571257 TGCCCTTCCCATGATGGAAGAGG + Intergenic
1097554737 12:61122631-61122653 TGCCCTTTCCATGATTAAAGAGG - Intergenic
1097821202 12:64130881-64130903 TGCCCTTTTCATGATGGAAGAGG + Intronic
1097843199 12:64341723-64341745 TGCCCTTTCCATGATGGAAAAGG + Intronic
1097843200 12:64341725-64341747 GGCCTTTTCCATCATGGAAAGGG - Intronic
1098158518 12:67624598-67624620 TACACCTTCCATGATGGAAGTGG - Intergenic
1098587151 12:72167368-72167390 TGTTCTTTCCATGATGTAAAGGG - Intronic
1098716245 12:73830832-73830854 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1098731201 12:74038365-74038387 TGTCCTTTCCATGATGGAAGAGG - Intergenic
1098749982 12:74280625-74280647 TGCCCTTTTCATGATGGAAGAGG - Intergenic
1098837381 12:75439083-75439105 TGACTTTTCCACGATGGAAGGGG + Intergenic
1099366076 12:81766409-81766431 TGACCTTTCTATAATGGAAGAGG - Intergenic
1099379245 12:81935519-81935541 TGCCATTTCCATGATGGAAGAGG + Intergenic
1099384365 12:81997153-81997175 TGCCCTTCTCAGGATGGAAAGGG - Intergenic
1099385566 12:82008843-82008865 TGGCCCTTCCAGGATTGAAGTGG - Intergenic
1099490527 12:83283223-83283245 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1099578209 12:84406427-84406449 TGCCTTTTTTATGATGGAAGAGG - Intergenic
1099689924 12:85939050-85939072 TGCCCTTTCTATGATGGAAGAGG - Intergenic
1099700739 12:86078521-86078543 TGCCCTTTCCATGATGGAAGAGG + Intronic
1100083451 12:90879235-90879257 TGTCCTTTCCATGATGGAAGAGG - Intergenic
1101001797 12:100364326-100364348 TACCCTTTCCAGGATGGAAGGGG + Intronic
1101222942 12:102659365-102659387 TGCCCCTTTCATGATGAGAGTGG - Intergenic
1101264285 12:103067144-103067166 TGCCCTTTCCATAATGGAAGAGG - Intergenic
1101534462 12:105604727-105604749 TGCCCTTTTCATGATGGAAGAGG + Intergenic
1101543214 12:105683663-105683685 TGCCCTTTTCTTGATGGAAGAGG - Intergenic
1103035774 12:117655101-117655123 TGCCCTTTCCATGATGGAAGAGG - Intronic
1103396681 12:120612476-120612498 TGCCCTTTCCATGATAGAAGAGG - Intergenic
1104106335 12:125663278-125663300 TGCCCTTTGCATGAAGGGAAGGG - Intergenic
1105428768 13:20318158-20318180 GACCCCTTCCATCATGGAAGGGG + Intergenic
1105428769 13:20318160-20318182 AGCCCCTTCCATGATGGAAGGGG - Intergenic
1105740267 13:23316209-23316231 TGCCCTTCCCATGATGGAAGAGG - Intronic
1106545265 13:30725610-30725632 GACCATTTCCATCATGGAAGGGG + Intronic
1106545266 13:30725612-30725634 TGCCCCTTCCATGATGGAAATGG - Intronic
1107266196 13:38558391-38558413 TGCCACTTCCATTATGGATGGGG + Intergenic
1107266197 13:38558393-38558415 TTCCCCATCCATAATGGAAGTGG - Intergenic
1107319066 13:39166535-39166557 TGCCCCTTCCAGGGTGGAAGAGG + Intergenic
1107983435 13:45754942-45754964 TGCCATTTCCATGATGGAAGAGG + Intergenic
1108004312 13:45931939-45931961 TGCCTTCTCCATTATGGATGAGG + Intergenic
1108904422 13:55450986-55451008 TGCCTTTTCCATGATGGAAGAGG - Intergenic
1109378064 13:61523959-61523981 TGCCTTTTCCAAGAAGGCAGTGG + Intergenic
1109392496 13:61710366-61710388 TGCCCCTTCCAAGACGAAAGTGG - Intergenic
1109519174 13:63485830-63485852 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1109583187 13:64367196-64367218 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1109705167 13:66080039-66080061 TGCCCCGTCCATGATGGAAGTGG - Intergenic
1109950874 13:69501186-69501208 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1110833991 13:80063602-80063624 TGCCTTTTCCATGATGCAAGAGG + Intergenic
1111016309 13:82386858-82386880 TGCCCTTTCCATGGTGGAAGAGG + Intergenic
1111057646 13:82971996-82972018 AGCCCTTTCCATAATGGAAGAGG + Intergenic
1111058725 13:82983785-82983807 CTGCCCTTCCATGATGGAAGAGG + Intergenic
1111275798 13:85945512-85945534 CACTCTTTCCATCATGGAAGAGG - Intergenic
1111317650 13:86582828-86582850 TGCCCTTTCCATGATGAAAGAGG - Intergenic
1111441023 13:88282769-88282791 TCTCCTTTCCATGGTTGAAGAGG - Intergenic
1111535341 13:89596200-89596222 TGCCCTTTCCCTGAGGGAAAGGG - Intergenic
1112738802 13:102451143-102451165 AGCCCTTTCCATCATAAAAGGGG - Intergenic
1113319553 13:109220645-109220667 TGTCCTTTCCATGATGGAAGTGG + Intergenic
1113673160 13:112188684-112188706 TGCCCTGTCCACAATGGAAGTGG + Intergenic
1114206013 14:20571796-20571818 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1114758105 14:25282851-25282873 TTTCCTTTCTATGATGGAAGAGG + Intergenic
1114905247 14:27119528-27119550 TGCCCTTTCCATGATGGAAAAGG + Intergenic
1115059851 14:29174911-29174933 TGCCCTTTCCATGATGGATGAGG - Intergenic
1115130835 14:30050291-30050313 CACCTTTTCCATGATGCAAGAGG - Intronic
1115310746 14:31975486-31975508 TGCTCCTTCCATGGTGGAAGTGG + Intergenic
1116059045 14:39897955-39897977 TGCCCTTTCTATGATAGAAGAGG - Intergenic
1116068240 14:40010197-40010219 TGCCCTTTCTATGATAGAAGAGG - Intergenic
1116158235 14:41235630-41235652 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1116218661 14:42053554-42053576 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1116307920 14:43282431-43282453 TGCCCCTTCCATGATGGAAGTGG + Intergenic
1116531318 14:45977212-45977234 TGCCCTTTTCATGAAGGAAGAGG + Intergenic
1116891722 14:50275364-50275386 TACCTTTTCTATGATGGAAGTGG - Intronic
1117217001 14:53561203-53561225 TGCCCTTTCCATGATGAAAGAGG - Intergenic
1117779974 14:59222379-59222401 TGTGCCTTCCTTGATGGAAGAGG + Intronic
1118423579 14:65633875-65633897 TGCCCTGTCCAGGAGGGAGGTGG + Intronic
1118880626 14:69822991-69823013 TGCCCTTTCTATGATGGAAGAGG + Intergenic
1118950604 14:70433545-70433567 TGCTCTTTCCATGATGAAAGAGG + Intergenic
1119059555 14:71461167-71461189 TGCCCTTTCCGTGATGGAAGAGG + Intronic
1120047496 14:79824487-79824509 TACCCTTTCCGTTGTGGAAGGGG + Intronic
1120081868 14:80226506-80226528 TGCCCTTCCCATGATGGAAGAGG + Intronic
1120231296 14:81844214-81844236 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1120498262 14:85262555-85262577 TGTCCTTTCCATGATGGAAGAGG + Intergenic
1120594539 14:86417407-86417429 TGTCCTTTCCATGATGAAAGAGG + Intergenic
1120710348 14:87787138-87787160 TGCCCCTTCCATGACGAAAGTGG + Intergenic
1120973847 14:90231826-90231848 TGCCCTTTCTGTAATAGAAGAGG - Intergenic
1122079273 14:99255868-99255890 TACACTTTCCAAGATGCAAGGGG - Intronic
1122622252 14:103066043-103066065 TGCCCTTTCCATGACAGAAGGGG - Intergenic
1123128261 14:105965246-105965268 TGCCCTTTCCAGGATGGAAGAGG - Intergenic
1202935339 14_KI270725v1_random:82667-82689 TCTCCTTTCCATGGTGGAAGAGG + Intergenic
1123408787 15:20041403-20041425 TGCCCTTTCCAGGATGGAAGAGG - Intergenic
1123518118 15:21048113-21048135 TGCCCTTTCCAGGATGGAAGAGG - Intergenic
1123765266 15:23471646-23471668 TGGCTCTTCCTTGATGGAAGTGG + Intergenic
1125483001 15:40093278-40093300 TGCTGTTGCCATGATGGACGGGG - Intronic
1126283747 15:46987283-46987305 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1127875316 15:63106755-63106777 TGCACTTTGCATGATGGAGGGGG - Intergenic
1128055658 15:64698115-64698137 GGCCCTTTCTCAGATGGAAGGGG - Intronic
1128642947 15:69353253-69353275 GACCCCTTCCATCATGGAAGAGG + Intronic
1128642948 15:69353255-69353277 TGCCTCTTCCATGATGGAAGGGG - Intronic
1129536285 15:76315918-76315940 TGCCTTTTCCAAGATAGAAGGGG + Intergenic
1130377064 15:83338593-83338615 TGGCCTTTCCATGATGGAAGGGG - Intergenic
1130668093 15:85886583-85886605 TGCCCTCTCGATGCTGGCAGTGG + Intergenic
1131664098 15:94551414-94551436 TTCCCTTCCAATGATGGACGTGG - Intergenic
1131724162 15:95203828-95203850 TGCCCTTTCGATGATGGAAAAGG - Intergenic
1131937903 15:97527219-97527241 TGCCTTTAGCATTATGGAAGAGG - Intergenic
1132217746 15:100079658-100079680 TACCTTTTCCATCATGGAAACGG + Intronic
1132217747 15:100079660-100079682 TGCCGTTTCCATGATGGAAAAGG - Intronic
1134399123 16:13892614-13892636 TGCCCCTGCTGTGATGGAAGGGG - Intergenic
1135061489 16:19274937-19274959 TGCCTCTTCGATGATGGAAGTGG + Intergenic
1135207364 16:20494538-20494560 TAGCCTTCCCATGATGGCAGTGG - Intergenic
1135211521 16:20529094-20529116 TAGCCTTCCCATGATGGCAGTGG + Intergenic
1135305214 16:21362017-21362039 TGCCCTTGGCTGGATGGAAGTGG - Intergenic
1135626148 16:23996525-23996547 GACCCCTTCCATTATGGAAGAGG + Intronic
1135626149 16:23996527-23996549 TGCCTCTTCCATAATGGAAGGGG - Intronic
1136631269 16:31490484-31490506 TGCCCTGCTCATGATGGCAGTGG + Exonic
1138868524 16:60851812-60851834 TGCCTTTTCCATGATGGAAGAGG - Intergenic
1141559395 16:84857010-84857032 TGCACTTTCTGTGATGGAAGAGG + Intronic
1141813175 16:86390205-86390227 TGCCCATTGCATGGAGGAAGTGG + Intergenic
1142003755 16:87679456-87679478 TGCCGGTGCCAGGATGGAAGAGG - Intronic
1146238127 17:31186968-31186990 TGCCCTTTCCGTGATGGAAGAGG - Intronic
1146758581 17:35455160-35455182 CGCCATTTCCATGATGGAAGAGG - Intergenic
1146836506 17:36115003-36115025 TGCCCTTTCCATGATGGAAAAGG - Intergenic
1146851084 17:36222062-36222084 TGCCCTTTCCATGATGGAAGAGG - Intronic
1149255026 17:54816462-54816484 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1149543661 17:57487526-57487548 TACCCTTTCCATGCTGCCAGAGG + Intronic
1151037654 17:70820578-70820600 TGCTCTTTCCATGTTGGTAGAGG + Intergenic
1151225363 17:72643910-72643932 TGCCCTTTCCATAATGGAAGAGG - Intergenic
1153089861 18:1331188-1331210 TGTCCTTTCCATGATGGAGGAGG - Intergenic
1154068616 18:11132108-11132130 TCCTCTTTCCATGTTGGAAGAGG - Intronic
1154252408 18:12755658-12755680 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1156116839 18:33795912-33795934 TGCCCCATCCATGGTGCAAGAGG + Intergenic
1156196206 18:34776743-34776765 TGCTTTTACCATGAGGGAAGTGG - Intronic
1156304003 18:35859720-35859742 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1156990164 18:43399751-43399773 TGCCTTTTCCATGATGGAAGAGG + Intergenic
1156998721 18:43498754-43498776 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1157054460 18:44210083-44210105 TGCTCCTTCCATGATGGAAGTGG - Intergenic
1157341353 18:46781037-46781059 TGCCCTTTTCATAATGGACGAGG - Intergenic
1157597646 18:48873574-48873596 TGCCCTTTCCCTGAGAGCAGGGG - Intergenic
1157870791 18:51228570-51228592 TGCCCTTTCCATGATGGGAGTGG + Intergenic
1158639108 18:59188207-59188229 TGCCCTCCCCATGATAGGAGAGG + Intergenic
1159151755 18:64531670-64531692 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1159287924 18:66376499-66376521 TGCCCATTCCATAATGGAAGAGG - Intergenic
1159558955 18:69974338-69974360 TGGCCTTTCCATGATGGAAGAGG + Intergenic
1159669005 18:71200104-71200126 TGCCCCTTTCATGATGGAAATGG + Intergenic
1159711436 18:71765145-71765167 TGCCCTTTCCATGATGTAAGAGG - Intronic
1160092593 18:75841039-75841061 TGCCCTTTCTGTGATGGAAGAGG - Intergenic
1161800183 19:6412991-6413013 TCCCCTTCCCATGTGGGAAGGGG - Intergenic
1165497482 19:36161975-36161997 TGCCCTCTTCATGACGGAAGAGG + Intergenic
1165743920 19:38219138-38219160 TGCTCTTTGCAGGAGGGAAGAGG + Intronic
1166525809 19:43508917-43508939 TACCCTTTTCTTGAAGGAAGGGG - Intronic
1168539180 19:57196380-57196402 TGCCCTTTCCATGATGGAAGAGG + Intronic
925105406 2:1286670-1286692 TGCCCTTTCCATGATGGAAGAGG + Intronic
925280106 2:2677887-2677909 TGCCCTTTCTATGATGGAAGAGG - Intergenic
925460872 2:4061469-4061491 TGCCCTTTCCGTGATGAAAGAGG - Intergenic
925499254 2:4485905-4485927 TGCCCTTCCCATGATGGAAGAGG + Intergenic
925666123 2:6258074-6258096 TGACCTGTCTTTGATGGAAGTGG - Intergenic
926810251 2:16749679-16749701 TGCCCTTTCCATGATGGAAGAGG + Intergenic
927008862 2:18880750-18880772 TTCCCTTTCCATGATGGAAGAGG - Intergenic
929550458 2:42887371-42887393 TGCCCCTTCCACAGTGGAAGTGG - Intergenic
930132694 2:47868849-47868871 TGCCTTTTTCATCATGGAAATGG - Intronic
930418728 2:51122001-51122023 TGTCCCTTCCGTGATGAAAGTGG - Intergenic
930481021 2:51948229-51948251 TGCCCTTTCCATGATGGAAGAGG + Intergenic
930536475 2:52651240-52651262 TGCCCTTTCCACGATGGCAGAGG + Intergenic
930852155 2:55972875-55972897 TGCTCATTCCATGAAGAAAGAGG + Intergenic
930910282 2:56621890-56621912 GGCCCTTTCCATGATGGAATAGG - Intergenic
931381970 2:61762077-61762099 TGCTCTTCCCAGGATGGCAGAGG - Intergenic
931648908 2:64451568-64451590 TGGCCTTGACATGGTGGAAGTGG - Intergenic
931821183 2:65953936-65953958 TGGCTTTTCTAGGATGGAAGGGG + Intergenic
932218373 2:69981945-69981967 GGCCATCTGCATGATGGAAGGGG + Intergenic
932447922 2:71791946-71791968 TCCTCTTTCCAAGAAGGAAGAGG - Intergenic
932870546 2:75394059-75394081 TGCCCCTTCCATGATGGAAGAGG + Intergenic
932975817 2:76598225-76598247 TGCCCTTTCCTTGATGGAAGAGG - Intergenic
933141051 2:78793313-78793335 TAGCCTTTCCATGAAGGCAGTGG + Intergenic
933394323 2:81712332-81712354 TGCCCTTTCTGTGATGTAAGAGG + Intergenic
933504637 2:83161743-83161765 TGCCCTTTCCATGATGGAAGAGG + Intergenic
933697899 2:85233786-85233808 TGCCTTTTCCAGGATATAAGTGG + Intronic
933839673 2:86276289-86276311 CGCCCACTCCATGAGGGAAGGGG - Intronic
934574954 2:95394164-95394186 TGCCTCTTCCATGATGGAGGAGG - Intergenic
935424964 2:102910310-102910332 TTCCCTTTCTGTGATGGAGGTGG + Intergenic
935526976 2:104182417-104182439 TTCCTCTTTCATGATGGAAGTGG - Intergenic
935564154 2:104589231-104589253 TGCCCTTTCCATGATGGAGGAGG + Intergenic
935869243 2:107427204-107427226 TTCTCTTTCCTTGATGGAAGTGG + Intergenic
936084838 2:109460297-109460319 TGCCCCTTCCTTGATGGAGGTGG + Intronic
936147538 2:109990827-109990849 TGCCTCTTCTATGATGGAGGTGG + Intergenic
936197154 2:110380614-110380636 TGCCTCTTCTATGATGGAGGTGG - Intergenic
936562901 2:113557292-113557314 TGCATCTTCCGTGATGGAAGTGG + Intergenic
936641365 2:114315716-114315738 TGCCCTTTACATGATGAAAGAGG - Intergenic
937563941 2:123260875-123260897 AGCCCTTTCCATGCTGTGAGTGG + Intergenic
937581918 2:123498123-123498145 TGCCCTTTCCATGATGGAAGAGG + Intergenic
937782699 2:125857441-125857463 TGCCTTTTTCTTGATGGGAGGGG - Intergenic
937800813 2:126078327-126078349 TCTCCTTTCTATGATGGAAGAGG - Intergenic
939069230 2:137518912-137518934 TGCCCTTTCCATGATGGAAGAGG - Intronic
939214012 2:139213263-139213285 TGCTGTTTCTATGATGGAAGAGG - Intergenic
939755465 2:146103916-146103938 TACCCTTTCCATTATAAAAGTGG - Intergenic
939806382 2:146779495-146779517 TTCCCTTTCCATGATAGAAGAGG - Intergenic
939870908 2:147524728-147524750 TGTCCTTTTCATGGTGGAGGAGG + Intergenic
940171162 2:150831688-150831710 TGCCCTTTCCAAGATGGAAGAGG + Intergenic
940471947 2:154112094-154112116 TGCCCTTTCCATGATGGAAGAGG + Intronic
940544236 2:155062796-155062818 TTCTCCTTCCATGATGGAAGTGG + Intergenic
941033408 2:160538792-160538814 TGACCCTTCCAGGATGGCAGGGG + Intergenic
941330516 2:164173538-164173560 TTCCTTTTCCATGATGAATGAGG + Intergenic
942322089 2:174744531-174744553 TACCCTTTCTATGATGGAAGAGG - Intergenic
943317780 2:186411300-186411322 TGCACTTTCCATGATGGAAGAGG + Intergenic
943383921 2:187180067-187180089 TGCCCTTTCCATGATGGAAGAGG + Intergenic
943385748 2:187202213-187202235 TGCCCTTTCCATGATGAAAGAGG + Intergenic
943517445 2:188906230-188906252 TGCCCTTTCCATGATGGAAGAGG + Intergenic
943833470 2:192490131-192490153 TGCCCTTTCCATGATGGAAGAGG + Intergenic
945545005 2:211139135-211139157 TGCCCTTTCCATGATGGAAGAGG - Intergenic
945642329 2:212444863-212444885 TGCCCTTTCCATGATGGAAGAGG - Intronic
945717690 2:213379644-213379666 TGCCCTTTCCATGATGGAAGAGG + Intronic
945725700 2:213470476-213470498 TGCCCCTTCCTTGATGGAAGAGG + Intronic
946527721 2:220539005-220539027 TGCCTTTTCCATGATGGAAGAGG + Intergenic
946533960 2:220606835-220606857 TGCCCTTTACATGATGGAACAGG + Intergenic
946703606 2:222436772-222436794 TGCCCTTTCCATGATAGAAGAGG + Intronic
946791053 2:223300778-223300800 TTCACTTTCCATGATGGAAGAGG - Intergenic
946873398 2:224105437-224105459 TATCCTTCCCATGATGGAAGTGG + Intergenic
947440992 2:230121279-230121301 TACCCTTTTCATGATGGAAGAGG - Intergenic
947591683 2:231389387-231389409 TGGCCTTTCCCAGGTGGAAGGGG - Intergenic
947626980 2:231625836-231625858 TGCCCTTTAGATGGCGGAAGAGG + Intergenic
948164354 2:235849980-235850002 TGCCCTGTCCTCCATGGAAGAGG - Intronic
1169448767 20:5693664-5693686 TTCCCCTTCCATGATGAATGTGG + Intergenic
1170882218 20:20306725-20306747 TGCCCTTTCCAGGCAGGCAGAGG + Intronic
1171110396 20:22475638-22475660 GGCCCTGTCCATGATGGACATGG - Intergenic
1172219694 20:33265062-33265084 TGCCTTTTCCAGGACTGAAGGGG - Intergenic
1173657072 20:44706782-44706804 TGCCTTTGCCATGGTGGGAGGGG - Intergenic
1173713729 20:45182658-45182680 AGCCCTTTCCACAATGAAAGAGG - Intergenic
1173756540 20:45521684-45521706 TGACCTGTCCCTGATGGAAGTGG + Intergenic
1173972628 20:47164382-47164404 TGCGCTTTCCTTGATGTCAGAGG - Intronic
1174013114 20:47466752-47466774 GGGCCTTTCTATGTTGGAAGAGG + Intergenic
1174423548 20:50416343-50416365 GCCCCTTTCCATGATGCGAGAGG + Intergenic
1175440488 20:58987476-58987498 TGTCCTTTCCATGAAGTTAGGGG + Intronic
1176596759 21:8704903-8704925 TCTCCTTTCCATGGTGGAAGAGG + Intergenic
1176998313 21:15581293-15581315 TTCCTTTTCCATGATGGAAGAGG - Intergenic
1177276858 21:18923354-18923376 TGCCTTCTCCAGGATGAAAGGGG + Intergenic
1178005896 21:28219407-28219429 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1178012809 21:28306202-28306224 TGCCCTTTGCATGATGGAAGAGG - Intergenic
1178736631 21:35158361-35158383 TACTTCTTCCATGATGGAAGTGG + Intronic
1179912876 21:44459656-44459678 TGCCCTTTCCCTGCTGCCAGGGG + Exonic
1180085320 21:45505551-45505573 TGCGGTTTCCAGGGTGGAAGCGG + Intronic
1180279679 22:10682345-10682367 TCTCCTTTCCATGGTGGAAGAGG + Intergenic
1180586895 22:16900875-16900897 TCTCCTTTCCATGGTGGAAGAGG + Intergenic
1180591001 22:16937341-16937363 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1181051528 22:20240386-20240408 TGCCCTGTGCTTGATGGGAGGGG + Intergenic
1181367160 22:22386850-22386872 TGCCCTTCCTGTGATGGAAGAGG + Intergenic
1181455814 22:23059605-23059627 GGCCCTTACCATGCTGGCAGAGG - Exonic
1182661641 22:31929327-31929349 TGCAGTTTCCATGAGGGCAGGGG - Intergenic
1182965856 22:34520324-34520346 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1183479771 22:38057164-38057186 TGCCCTTCCCAAGATGGCGGCGG + Intronic
1184603413 22:45557340-45557362 TGCCATTTCCATGATGGAAGAGG + Intronic
1184616351 22:45640885-45640907 TGCCTCTTCCAGGGTGGAAGGGG - Intergenic
949125314 3:440212-440234 TGCCCTTTCCATGATGGAAGAGG + Intergenic
949125519 3:442086-442108 TGCCATTTCTATGATGGAAGAGG + Intergenic
949169890 3:985575-985597 TGCCCTTTCCATGATGGAAGAGG + Intergenic
949373010 3:3355347-3355369 GGCTCTTTACATGGTGGAAGGGG - Intergenic
949417435 3:3829874-3829896 TGCCCTTTTCATGATGGAAGAGG + Intronic
949445763 3:4132084-4132106 TGCCCTTTCCATGATGGAAGAGG - Intronic
949511183 3:4768623-4768645 TGCCCTCTCCAGGCTGGTAGTGG - Exonic
949639053 3:6014541-6014563 TGCCCTTTCTATGATAAAAGAGG - Intergenic
949906062 3:8859395-8859417 TGCCCCTTCCATGATAGAAGTGG - Intronic
950567143 3:13776495-13776517 TTCTCCTTCCATGATGGAAGTGG - Intergenic
951003714 3:17593512-17593534 TGCCCTTTCCATCGTGGAACAGG - Intronic
951291375 3:20875717-20875739 TACCCTTTCCATGATGGAAGAGG + Intergenic
951384665 3:22028544-22028566 TACCCTTTCCGTGATGGAAGAGG - Intronic
951970620 3:28440861-28440883 TGCCTTTTCCATGGTGATAGAGG + Intronic
953371269 3:42390519-42390541 TGCTCCTGCCATGATGAAAGGGG - Intergenic
954054310 3:48008964-48008986 TGCCCTTTCCATGATGGAAGAGG - Intronic
954481282 3:50803799-50803821 TGCCCCTTCCAGGAGGGAGGTGG - Intronic
954511339 3:51128645-51128667 TGCGCTTTCTGTGATAGAAGAGG + Intronic
955301037 3:57779877-57779899 AGTGCTTGCCATGATGGAAGGGG + Intronic
955418488 3:58714832-58714854 TGCAACTTCCATGGTGGAAGTGG + Intergenic
955801810 3:62694525-62694547 TGTCCCTTCTATGATGGAAGGGG - Intronic
956047788 3:65214892-65214914 TGCTCTTTCTATGGTGGAAGGGG - Intergenic
956307009 3:67836656-67836678 TGCCCTTTCCGTGATGAAAGAGG - Intergenic
956509815 3:69981391-69981413 TGCCCTTTCAATGATGGAAGAGG - Intergenic
956566099 3:70640180-70640202 TACCCCTTCCATGATGGAAGTGG + Intergenic
957247424 3:77732874-77732896 TGCCCTTTCCATGATGGAAGAGG + Intergenic
957283450 3:78184240-78184262 TGGCCCTTCCAGGATTGAAGAGG + Intergenic
958024925 3:88039418-88039440 TGCCCCTTCTATGATGGAAGAGG + Intergenic
958487533 3:94731448-94731470 TTCCCTTTCCATGATGGAAGTGG + Intergenic
958845638 3:99261398-99261420 TGCCCTTCCCATGATGGAAGAGG + Intergenic
958934455 3:100241637-100241659 TGCCATTTCCATGATGTAAGAGG - Intergenic
959226634 3:103596255-103596277 TGCTCTTTCCATGATGGAAGAGG + Intergenic
959377316 3:105602665-105602687 TGCCTTTTGCATGATGGAAGAGG + Intergenic
959998018 3:112699345-112699367 TGCCCTTTCCATGATGGAAGAGG - Intergenic
960349662 3:116576726-116576748 TGCCCTTTCCATGATATAAGAGG - Intronic
960494592 3:118359731-118359753 TGCCCTTTCCATGATGGAAGCGG + Intergenic
961263001 3:125617413-125617435 TGTCCTTTCCATGATGGAAGAGG - Intergenic
961710833 3:128826993-128827015 TGCCTTTTCCATGATGGAAGAGG + Intergenic
962068770 3:132011414-132011436 GGCCCTTTTAATGATGGAAAGGG + Intronic
963331658 3:143922348-143922370 TGCCCTTTCTGTGATGGAAGAGG + Intergenic
963379095 3:144506258-144506280 TGCTCTTTCCATGATGGAAGAGG + Intergenic
963544052 3:146632367-146632389 TGACCTTTCCAGTATGGGAGGGG + Intergenic
963661533 3:148133163-148133185 TGCCATGTGCATGATGGAAGAGG - Intergenic
964505561 3:157395274-157395296 TGTCCCTTCCATAATGGAAGTGG + Intronic
964949228 3:162267281-162267303 TGACCCTTCCATGAGGGACGTGG + Intergenic
965034852 3:163424908-163424930 TGCCTTTTCCGTGATGGAAGAGG + Intergenic
965226613 3:165999745-165999767 TGCCCTTTCCATGATGGAAGAGG + Intergenic
965291601 3:166888566-166888588 TGCCCTTTCTATGATGGAAGAGG + Intergenic
965642852 3:170849196-170849218 TGTCCTTTCCACGTTTGAAGAGG - Intronic
965647896 3:170903107-170903129 TGCCTGTTTCATGATGGAAGGGG - Intronic
966044183 3:175529894-175529916 TGCCCTTTCCATAATGGAAGAGG + Intronic
966445834 3:179999585-179999607 TGCCCTTTCTATGATGGAAGAGG - Intronic
966896540 3:184449221-184449243 TGCCTCTTCCATGATGGAAGTGG + Intronic
968800336 4:2739156-2739178 TGCCCTTTCCATGATGGAAGAGG - Intergenic
968907162 4:3459438-3459460 TGCCCTTTCCAGGATGGAAGAGG - Intergenic
969548996 4:7851842-7851864 TGATCTCTTCATGATGGAAGTGG - Intronic
970629434 4:17924528-17924550 TGCCCTTTCCATGATGGAAGAGG - Intronic
970644931 4:18108944-18108966 TGCCCTTTCCATGATGGAAGAGG + Intergenic
971100872 4:23465395-23465417 TGCCCTTTCCATGGTGGAAGAGG + Intergenic
971126579 4:23761333-23761355 TGTCCTTTCCATGATGGAAGAGG - Intronic
971460354 4:26889537-26889559 TGCCCCATTCATGATGGCAGTGG + Intronic
971687240 4:29786062-29786084 TGCCCTTTCCACGATGGAAAGGG + Intergenic
971857515 4:32061829-32061851 TGCCCATACCATGATGGAAGAGG + Intergenic
971886975 4:32463117-32463139 TGCCTTTTCCATGAAAGATGGGG - Intergenic
972085364 4:35208111-35208133 TGCCCTTTCCATGATGGAAGAGG - Intergenic
972095626 4:35343717-35343739 TGCCCTTTCCATGATAGAAGAGG - Intergenic
972201159 4:36716157-36716179 TGCCCTTTCCATGATGGAAGAGG + Intergenic
972882829 4:43447147-43447169 TGCCTTTTCCATGATGAAAGAGG + Intergenic
973103067 4:46295769-46295791 TGCCCTTTCCATGATGGAAGAGG - Intronic
973130037 4:46638677-46638699 TGCCTTTTCCATGATAAAAGAGG + Intergenic
973226672 4:47792866-47792888 TGTCCTTTGCAAGATGGCAGGGG - Intronic
974243471 4:59283009-59283031 TGTCCTTTCCATAACAGAAGTGG + Intergenic
974289710 4:59913765-59913787 TGCCCTTTTCATGATTGAAGAGG - Intergenic
974478909 4:62419866-62419888 TGCCCTTTCCATGATGGAAGAGG + Intergenic
974564926 4:63569336-63569358 TGCCCTTTCCATGATGGAAGAGG - Intergenic
974644473 4:64673759-64673781 TGTCCTTTCCATGTTGGAAGAGG + Intergenic
974727368 4:65813564-65813586 TGCCCTTTCCATGATGGAGGAGG - Intergenic
974786521 4:66625062-66625084 TGCTTCTTCCATGATGGAAGTGG - Intergenic
975135489 4:70870222-70870244 TGCCCCTTCCGTGATGGGGGTGG + Intergenic
975160345 4:71117720-71117742 TGACCCTTCCAAGATGGAAAGGG + Intergenic
975386578 4:73766487-73766509 TGCTCTTTCCGTGATGGAAGAGG + Intergenic
975982459 4:80176252-80176274 TGCTCTTTCTATGATGGAAGAGG + Intergenic
976034057 4:80794797-80794819 TACCTTTTCCATAATGGAAGAGG + Intronic
976106439 4:81623923-81623945 TTCCCTTTCAATGAGGGAAAAGG + Intronic
977083725 4:92567895-92567917 TGCACTTTCCATGAGGGCAAGGG - Intronic
977204857 4:94156660-94156682 TGCCCCTTCCATGACGGAAGAGG - Intergenic
977430914 4:96929233-96929255 TGCCCTTTCCATGATGGAAGAGG - Intergenic
977701600 4:100028860-100028882 TGCCCTTTCCGTGATGGAAGAGG + Intergenic
977833077 4:101616818-101616840 TGCCCTTTCCATGATGCAAGAGG + Intronic
977846976 4:101778238-101778260 TACCCCTTCCTTGATGGAAGTGG + Intronic
978038308 4:104024871-104024893 TGGAATTTCCATGATGGAAATGG - Intergenic
978341429 4:107724523-107724545 TGCCCTTTCCATGATGCAAGAGG + Intergenic
978485777 4:109252202-109252224 TGCCCCTTCTATGATGGAAGAGG + Intronic
978772009 4:112466762-112466784 TGCCATTTCCATGATGGGAGAGG + Intergenic
978986216 4:115015944-115015966 TGCTCCTTCCATGCTAGAAGTGG - Intronic
979767154 4:124475621-124475643 TGCCCTTTCAATGATAGAAGAGG - Intergenic
979888428 4:126061156-126061178 TGCCCTTTCCATGATGGAAGAGG + Intergenic
980034636 4:127869696-127869718 TCCCCCTTCCATGGTAGAAGGGG + Intergenic
980245132 4:130229168-130229190 TACCCTTTCCAGTATGGAAGAGG + Intergenic
980385651 4:132086034-132086056 TGCCCTTTTCATGATGGAAGAGG + Intergenic
980405744 4:132352764-132352786 AGTCCTTTCAATGATTGAAGAGG + Intergenic
980602355 4:135041035-135041057 TGCCCTTTCCAGGATAGAAGAGG - Intergenic
980629659 4:135415288-135415310 TACCCTTTCCATGATGGAAGAGG - Intergenic
980957881 4:139446940-139446962 TACCCTTTACATGATAAAAGAGG - Intergenic
981835148 4:149044964-149044986 TGCCCTTTCCATGATGGAAGAGG - Intergenic
981873683 4:149516223-149516245 TGCCTTTTCCATGATGGAAGAGG - Intergenic
981979240 4:150771595-150771617 TGCCCCTTCTATGATGGAAGGGG + Intronic
982597630 4:157406028-157406050 TGACCTTTCCATAATGGAAGAGG + Intergenic
982623187 4:157731862-157731884 TGCCCTTTCCATGATAAAATAGG + Intergenic
982788089 4:159559372-159559394 TGCCCATTCTATGATGGGTGGGG + Intergenic
982835696 4:160117671-160117693 TGCCCTTTCCATGATGGAAGAGG - Intergenic
983027550 4:162756314-162756336 TGCCCTTTCCATGATGGAAGAGG - Intergenic
984060138 4:174981002-174981024 TACTCTTCCCATGATGGAAGAGG + Intergenic
984864722 4:184271863-184271885 TGGCTTTCCCATGCTGGAAGGGG + Intergenic
985832470 5:2244331-2244353 TGCCCTTTCCATGATAGAAGAGG - Intergenic
986261489 5:6151498-6151520 TGCTCTTTCCATGATGGAAGAGG + Intergenic
986531253 5:8739292-8739314 TGCCCTTTCCATGATGGAAGAGG + Intergenic
986766308 5:10931330-10931352 TGCCCTTTCCATGGTGGAAGAGG - Intergenic
986938194 5:12917726-12917748 TGCCCTTTCCATGATGGAAGAGG + Intergenic
986959979 5:13200208-13200230 TGCCCTTTCCATGATGGAAGAGG - Intergenic
987153331 5:15062690-15062712 TGCCATATCCATGATGGAAGAGG - Intergenic
987389815 5:17365347-17365369 TTCCCTTCCCATGTTGAAAGTGG + Intergenic
987515256 5:18898758-18898780 TGCCATTCCCATTATGGAGGAGG - Intergenic
987578197 5:19757285-19757307 TGACCTTTCCATGATGGAGGAGG + Intronic
987960646 5:24804065-24804087 TGCCAGTTCCATGAGAGAAGGGG - Intergenic
987967731 5:24897168-24897190 TGCCCCTTCCATGATAGAAGTGG - Intergenic
988079684 5:26400404-26400426 TGCTCTTTCCCTAATAGAAGAGG + Intergenic
988092573 5:26562310-26562332 TGCCATTTCCATGATGACAGAGG - Intergenic
988160677 5:27515844-27515866 TGCCCTTTGTATGATGGAAGAGG + Intergenic
988169063 5:27631812-27631834 TGCCCTTTCCATGATGGAAGAGG + Intergenic
988205154 5:28124327-28124349 TGCCCTTTCCATGATGGAAGAGG + Intergenic
988228899 5:28449151-28449173 TGCCCTTTCCATAACGGAAGAGG - Intergenic
988233160 5:28506064-28506086 TGCTTTTTCCATGATTGAAGTGG + Intergenic
988400057 5:30750919-30750941 CGGGCTTTCCATGATAGAAGGGG + Intergenic
988562275 5:32291865-32291887 TGCCCTTTCAATGATAGAAGAGG - Intronic
988785376 5:34561888-34561910 TGCCCTTTCCATGATGGAAGAGG + Intergenic
989247735 5:39273002-39273024 TGCCCTGTCCAGGAGGGAGGTGG + Intronic
989486240 5:41995334-41995356 TGCCCTTTCTATGATGGAAGAGG + Intergenic
990289057 5:54330308-54330330 TGCCACTTCTATAATGGAAGTGG + Intergenic
990748182 5:58982566-58982588 TACCCTTTCCACCATGGAAGTGG + Intronic
991013643 5:61909866-61909888 TGCCCTTTCATTGATGGAAGAGG + Intergenic
991033698 5:62106945-62106967 TGCCCTTTCATTGATGGAAGAGG - Intergenic
991330592 5:65488656-65488678 TGCCCTTTCCATGATGGAAGAGG + Intergenic
991946294 5:71901150-71901172 TGCCCTTTCCATGATGGAAGAGG - Intergenic
992093245 5:73338271-73338293 TTCCTTTTCCAGGATGGAAGCGG + Intergenic
992243102 5:74790878-74790900 TGCTCTTTCCATGATAGAAGAGG - Intronic
993203539 5:84848569-84848591 TGCCCTTTCCATGATGGAAGAGG - Intergenic
993231766 5:85246517-85246539 TGCTCTTTCCATGATAGAAGAGG + Intergenic
993319966 5:86459597-86459619 TGCCCTTTCCATGATGGAAGGGG - Intergenic
993412430 5:87590793-87590815 TGCTCTTTCCATGATGGAAGGGG + Intergenic
993537639 5:89106267-89106289 TGCCTGTTCCGTGATGGAAGTGG + Intergenic
993780820 5:92063416-92063438 TGCCCTTTCCATGATGGAAGTGG - Intergenic
993840705 5:92875670-92875692 TGGGCTTTCCATGAAGGCAGTGG + Intergenic
994159866 5:96545516-96545538 CTGCCTCTCCATGATGGAAGAGG + Intronic
994291219 5:98030928-98030950 TGCCCTTTCCATGATGGAAAAGG + Intergenic
994984262 5:106914701-106914723 TGCCCTTTCCATGATAGAAGAGG + Intergenic
995135258 5:108673528-108673550 TGCCCTGTGCATGATGGAGGAGG + Intergenic
995269418 5:110204454-110204476 TTCCCTATCCAGGATGGAACAGG + Intergenic
995330797 5:110943844-110943866 TTCCTTTTCTATGAGGGAAGGGG + Intergenic
995591941 5:113708514-113708536 TGCCCTTTCCACAGTAGAAGGGG - Intergenic
995594350 5:113731770-113731792 TGCTCTGGTCATGATGGAAGAGG - Intergenic
995776136 5:115726683-115726705 TGCCCTTTCCATGATGGAAAAGG + Intergenic
995827233 5:116314374-116314396 TGCCCATTCCAAGATAGAAGGGG - Intronic
996018704 5:118568896-118568918 TGCCCTTTCTATGATGGATGAGG - Intergenic
996043541 5:118843994-118844016 TGCTCCTTCCTTGATGAAAGTGG + Intronic
996164821 5:120211490-120211512 TGCCCTTTCCATGATGGAAGAGG + Intergenic
996232104 5:121078396-121078418 TCTCCTTGCTATGATGGAAGCGG + Intergenic
996392059 5:122972764-122972786 TGCCTTTTCCATGATGGAAGAGG + Intronic
996825712 5:127678853-127678875 TGCCCTTTCCATGATAGAGGAGG - Intergenic
996912300 5:128669720-128669742 TGCCCCTTTTATGATGGAAGAGG + Intronic
997871694 5:137511337-137511359 TGCCCATTCCAAGTTGGAAGAGG + Intronic
998290183 5:140907527-140907549 TGCCCTTTCTATGATGGAAGAGG + Intronic
999351522 5:150875858-150875880 TGTCCTTTCCATGATGGAAGAGG - Intronic
999676146 5:154004900-154004922 TGCTCTTTACATGATGTAACAGG + Intronic
1000417120 5:160994927-160994949 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1000422725 5:161056845-161056867 TGCCTCTTCCATGATGGAAGTGG + Intergenic
1002213541 5:177612152-177612174 TGCCCTTTCCAGCAGGGGAGAGG - Intergenic
1002998120 6:2305786-2305808 TGCCCTTTTCATGATGGAAGAGG - Intergenic
1003088521 6:3081426-3081448 TGCCCTTTTCATCCTGGAATGGG + Intronic
1003334588 6:5158829-5158851 TGCCTTTGCCAGGCTGGAAGAGG + Intronic
1003695753 6:8405137-8405159 TGCCCTTTCCATGATGGAAGGGG + Intergenic
1003758760 6:9151111-9151133 TGCCCTTTCTGTGATGGAAGAGG - Intergenic
1003791378 6:9551074-9551096 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1004298727 6:14437684-14437706 TGCCCCTTCCCTAATAGAAGTGG - Intergenic
1004613286 6:17266522-17266544 TGCTCGTTCCATGGTGGAGGGGG - Intergenic
1004824144 6:19402208-19402230 TGCCCTTTCCTTGATGGAAGAGG + Intergenic
1004945191 6:20604412-20604434 TGCCCCCTCCATGATGGAAGAGG - Intronic
1005185322 6:23158091-23158113 TGCCCTTTCCATGATGGAAAAGG - Intergenic
1005836537 6:29713753-29713775 TGGCCCTTCCAGAATGGAAGTGG - Intergenic
1006062491 6:31434228-31434250 TGCCCTTTCCATAATGGAAGAGG - Intergenic
1006068694 6:31481202-31481224 TGCCTTTTCCATGGTAGATGTGG + Intergenic
1007201746 6:40115489-40115511 TGGCCCTTCTAAGATGGAAGGGG - Intergenic
1007646219 6:43383345-43383367 TGCCCTGTCCATGAAGGAAGAGG + Intergenic
1008079238 6:47177543-47177565 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1008340406 6:50357305-50357327 TGCCCTTTTCATGATGGAAGAGG - Intergenic
1008400430 6:51056492-51056514 TGCCCTTTCCATGTTGGAAGAGG - Intergenic
1008820540 6:55626168-55626190 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1009806635 6:68607970-68607992 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1009851770 6:69207931-69207953 TGCCCTTTCCATGATGAAAGAGG + Intronic
1010107800 6:72189545-72189567 TGCCCTTTCCATGATGGAAGAGG + Intronic
1010323716 6:74541516-74541538 TGCCCATTCCATGATGGAAGAGG - Intergenic
1010753082 6:79636356-79636378 TGCCCTATCCAAAATGCAAGTGG + Intronic
1010818776 6:80389435-80389457 TGCCCTTTCCATTACGGACAAGG - Intergenic
1010938099 6:81885397-81885419 TGCCCTTTCCATAATGGAAGAGG + Intergenic
1011039206 6:83012274-83012296 TGCCCTTTCCATGATGGAAGAGG + Intronic
1011069255 6:83362680-83362702 TGTCCTTTACATGATGGAAGAGG - Intronic
1012194984 6:96330320-96330342 AGGTCATTCCATGATGGAAGTGG - Intergenic
1012310963 6:97723457-97723479 TGCCCTTTTCAAAATGGAAAGGG - Intergenic
1012402947 6:98859451-98859473 TGCCCCTTCTATGATAGAAGTGG + Intergenic
1012511143 6:100003166-100003188 TGCCCCTTCCATGATGGAACTGG + Intergenic
1012920640 6:105218522-105218544 TGCCCTTTTCATGATGGAAGAGG + Intergenic
1013098397 6:106966945-106966967 TGCCCCTTCCATGATGGAAGAGG - Intergenic
1013301889 6:108811624-108811646 TGCCCTATGCATCGTGGAAGTGG + Intergenic
1014299194 6:119659430-119659452 AGCCATTGCCATGAGGGAAGTGG - Intergenic
1014363255 6:120507322-120507344 TGCCATTTCCATGATGGAAGAGG + Intergenic
1014417143 6:121196432-121196454 TGCCCTTTCCATAATGGAAGAGG - Intronic
1014455870 6:121634548-121634570 TGCCTGTTCCATGTTGGAAGAGG - Intergenic
1014534041 6:122595578-122595600 TGCCCTTTCCATGATGGAAGAGG + Intronic
1014577487 6:123091547-123091569 TGCCTTTGCCATGCTGGAAATGG + Intergenic
1014631788 6:123797819-123797841 TGCCCTTCTCATGATGGAAGAGG - Intergenic
1014895785 6:126897600-126897622 TTCCCTTTCTATGATTAAAGTGG - Intergenic
1015095308 6:129408590-129408612 CTGCCTTTGCATGATGGAAGAGG + Intronic
1015443138 6:133271536-133271558 TTCCCTTTCTATGATGGAAGAGG + Intronic
1015475901 6:133658508-133658530 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1015492500 6:133842250-133842272 ACCCCTTTCCAAAATGGAAGCGG - Intergenic
1015839698 6:137463687-137463709 TGACCTCTCCATGCTGCAAGGGG - Intergenic
1016002979 6:139061564-139061586 TGTCCTTTGCAGGATGGAACTGG + Intergenic
1016147179 6:140691688-140691710 TGCCCTATCCATTATGGAAGAGG + Intergenic
1016419470 6:143869643-143869665 TGCCTTTTCCATGATGGAAGAGG + Intronic
1016576119 6:145571563-145571585 TACCCTTTCCATTATGGAAGAGG + Intronic
1017227664 6:152040061-152040083 TGTTCTTTCTGTGATGGAAGAGG + Intronic
1017408848 6:154148285-154148307 TGCTTTTTCCCAGATGGAAGGGG + Intronic
1017452459 6:154566565-154566587 TACCCCTTCCATCATGGAAGGGG + Intergenic
1017452461 6:154566567-154566589 TCCCCCTTCCATGATGGAAGGGG - Intergenic
1017976887 6:159366121-159366143 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1018215983 6:161528370-161528392 TCACCTTTCCTTCATGGAAGGGG - Intronic
1018534887 6:164809481-164809503 TGCCCTTTCCATGGTGGAGGAGG + Intergenic
1018600033 6:165528526-165528548 TGCCCTTTCCATGATGGAAGAGG - Intronic
1018780968 6:167065028-167065050 TGTCCTTTCCATGATGGAAATGG + Intergenic
1018907015 6:168081367-168081389 TGGCCTGTTCGTGATGGAAGAGG + Intronic
1019270008 7:141725-141747 TGAGCCTTCCATGTTGGAAGTGG + Intergenic
1019270019 7:141776-141798 TGAGCCTTCCATGTTGGAAGTGG + Intergenic
1019270030 7:141827-141849 TGAGCCTTCCATGTTGGAAGTGG + Intergenic
1019412984 7:914629-914651 TGCCCTTTGCTGGATGGATGAGG - Intronic
1020180482 7:5918701-5918723 TGCCCATTCCATGATGCGAGGGG - Intronic
1020302449 7:6806181-6806203 TGCCCATTCCATGATGCGAGGGG + Intronic
1020437763 7:8184308-8184330 TGCCATTTCCATGCTCCAAGAGG + Intronic
1020956989 7:14752150-14752172 TATCCTTTCCATAATGGAAAGGG + Intronic
1021988964 7:26123947-26123969 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1022079036 7:27001356-27001378 TGCCATTTCCATGGTGGAAGAGG - Intergenic
1023855631 7:44181889-44181911 CGCCCTTTCCAGGTTGGAAGGGG - Intronic
1024032117 7:45469951-45469973 TGCCTATTCCATGATGGAAGAGG - Intergenic
1024040691 7:45551172-45551194 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1024342864 7:48284893-48284915 TTCCCTTTATATGATGGGAGAGG - Intronic
1024709949 7:52004376-52004398 TGCCCTTATCATCAAGGAAGAGG + Intergenic
1024743110 7:52376555-52376577 TGCCCTCCCCATGATTGAACAGG - Intergenic
1024884206 7:54123620-54123642 TACCCTTTCCATTATGGAAGAGG + Intergenic
1026207731 7:68272748-68272770 TGCCCCTTTCATGATGGAAGAGG - Intergenic
1026425038 7:70282491-70282513 TGTCCTTTACATGGTAGAAGGGG + Intronic
1027377981 7:77573400-77573422 TGCACTTCACATGGTGGAAGGGG + Intronic
1027406909 7:77871980-77872002 TGCCCTTTCCGTGATGGAAAAGG + Intronic
1027685943 7:81278980-81279002 TGCCTTTTCCGTGATGGAAGAGG - Intergenic
1027757665 7:82235407-82235429 TGAACTTTCCCTGATGGGAGGGG + Intronic
1028043991 7:86092487-86092509 TGCGTTTTCCATGATGCGAGAGG - Intergenic
1028233849 7:88336946-88336968 TGCCCTCTCCTTGATAGCAGGGG + Intergenic
1028237974 7:88383845-88383867 TGCCCTTTCCATAATGGAAGAGG - Intergenic
1028935161 7:96456090-96456112 TGCTTTTTTCATGATGGAAGAGG - Intergenic
1030192554 7:106824054-106824076 TGCCCATCCTATGATGGAAGTGG - Intergenic
1030277693 7:107737665-107737687 TGCTCTTTCTATGATTTAAGAGG - Intergenic
1030368909 7:108675065-108675087 TGCCCTTTCCATGATGGAAAAGG - Intergenic
1030883134 7:114905522-114905544 TGCCCTTTCCATGTTGGAAGAGG + Intergenic
1031237003 7:119189276-119189298 AGCCCTTTCCATAATAAAAGTGG - Intergenic
1031474309 7:122204334-122204356 TGCCCTTTCCATGAGGGAAGTGG + Intergenic
1031676690 7:124619311-124619333 TGCCCTTTCCATGATGGAAAAGG - Intergenic
1031682174 7:124688373-124688395 TGCCCTTTTCATGATGAAAAAGG - Intergenic
1031833152 7:126651041-126651063 TGCCCTTTCCGTGATGGAACAGG - Intronic
1032152953 7:129445934-129445956 TGCCCTTTCCATGACAGAAGAGG + Intronic
1032425893 7:131821845-131821867 TGCAGTTTCAATGGTGGAAGAGG + Intergenic
1032680586 7:134178723-134178745 TTCCCTTTCTCTGAGGGAAGGGG + Intronic
1032923337 7:136575103-136575125 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1033076413 7:138254072-138254094 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1033368969 7:140691957-140691979 TGCTGTTCCCAGGATGGAAGAGG + Intronic
1034169955 7:149055288-149055310 TACTGTTTTCATGATGGAAGAGG - Intergenic
1034367110 7:150560645-150560667 TGCTCTTTCTATCATAGAAGTGG + Intergenic
1034893502 7:154860248-154860270 CGCCCTGTGCTTGATGGAAGGGG - Intronic
1037364440 8:18107237-18107259 TGCCCTTTCCATGGTGGAAGAGG + Intergenic
1037463393 8:19135803-19135825 GGCCCTTTTCATGGTGGGAGGGG + Intergenic
1037613870 8:20499624-20499646 TGCCCATTTCTGGATGGAAGTGG + Intergenic
1037614176 8:20502523-20502545 TGCCCATTTCTGGATGGAAGTGG + Intergenic
1037953803 8:23037420-23037442 TGCCCCCTCCATGATAGAAATGG - Intronic
1038086391 8:24202042-24202064 TGCCCTTTCCTTGATCCAGGAGG + Intergenic
1038722911 8:30054143-30054165 TGCCCCTTTCATGATAGAAGTGG + Intergenic
1039192346 8:34990994-34991016 TGCACTTTGCATTATGGAAATGG - Intergenic
1039324028 8:36465520-36465542 TGCTCTTTCCATGATGGAAGAGG + Intergenic
1039391439 8:37184094-37184116 TTCCCTCTCCCTGATCGAAGTGG + Intergenic
1040710902 8:50187838-50187860 CTGCCCTTCCATGATGGAAGTGG + Intronic
1040912088 8:52529440-52529462 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1041094562 8:54336203-54336225 TGCTGTTTCCAAGATTGAAGAGG + Intergenic
1041448072 8:57975506-57975528 TGCCCCTTGCATGATGGAAGTGG + Intergenic
1041556216 8:59159334-59159356 TGTCCTTGCCTTGATGAAAGTGG - Intergenic
1041986332 8:63925495-63925517 TACCCTTTCCATTACAGAAGAGG - Intergenic
1042000912 8:64122969-64122991 TGCCCTTTCCATGATGGAAAAGG + Intergenic
1042342566 8:67695412-67695434 TATCCCTTCCATGATGTAAGAGG - Intronic
1043235332 8:77857854-77857876 TTCCCCTTCTATGATGAAAGCGG - Intergenic
1044202535 8:89453513-89453535 TTCCCTTTCCATGATGGAAGAGG - Intergenic
1044285829 8:90411420-90411442 TGCCTTTTCCATGATGGAAGAGG + Intergenic
1044487009 8:92766158-92766180 TGTCCTTTCCATGATGGAAGAGG + Intergenic
1044632997 8:94297377-94297399 TGCCCTTTACATGTTGCAAAAGG + Intergenic
1044895918 8:96891293-96891315 TGCCCTTTCCATGATGGAAAAGG + Intronic
1045391420 8:101718738-101718760 TGCTCAGGCCATGATGGAAGGGG + Intronic
1046128525 8:109940571-109940593 TGCTCTTTCCGTGATGGAAGAGG + Intergenic
1046197698 8:110885226-110885248 TGCCCTTTCCCTGATGGAAAAGG - Intergenic
1046417508 8:113936779-113936801 TGATCTTTCCATGGTGGAAGAGG + Intergenic
1046585639 8:116146713-116146735 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1048820561 8:138376528-138376550 GGCCCTTACCATGATTCAAGAGG + Intronic
1048943288 8:139421600-139421622 TGCTTCTTTCATGATGGAAGTGG - Intergenic
1049843501 8:144788730-144788752 TGGCCTTTCCCTGCTGGCAGGGG - Intergenic
1049889832 9:58407-58429 TGCATCTTCCGTGATGGAAGTGG - Intergenic
1050154592 9:2652547-2652569 TGCCCTTGCCTGGATGGATGTGG + Intronic
1050482828 9:6103622-6103644 TGTCCTTTCCATGATGTAAGAGG - Intergenic
1050556389 9:6792976-6792998 TGCCCTAACCATCATGGAGGTGG + Exonic
1051381393 9:16462657-16462679 CGCCATTTCCATTGTGGAAGAGG - Intronic
1051468070 9:17403519-17403541 TGCCTCCTCCATGATGGAAGAGG - Intronic
1051475948 9:17509303-17509325 GGCCCCTTCCATGATGGCAGTGG - Intergenic
1051589854 9:18766695-18766717 TGTCCTCCACATGATGGAAGGGG + Intronic
1052227724 9:26109398-26109420 ATCGCTTTCCATGATAGAAGAGG - Intronic
1052368799 9:27641862-27641884 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1052442120 9:28511270-28511292 TGCACTTTCCATGATGGAAGAGG + Intronic
1052561426 9:30088974-30088996 TGCCCTTTTCCTGATGGAAGAGG + Intergenic
1052737193 9:32354552-32354574 TGCCCTTTCCATGATAGAAGAGG + Intergenic
1053610944 9:39712376-39712398 TGCCCTTTCCATGATGAAAGTGG - Intergenic
1053731312 9:41059682-41059704 TGCATCTTCCATGATGGAAGTGG - Intergenic
1053868986 9:42470398-42470420 TGCCCTTTCCATGATGAAAGTGG - Intergenic
1054087310 9:60758782-60758804 TGCCCTTTCCATGATGAAAGTGG + Intergenic
1054242578 9:62630019-62630041 TGCCCTTTCCATGATGAAAGTGG + Intergenic
1054556701 9:66664537-66664559 TGCCCTTTCCATGATGAAAGTGG + Intergenic
1054697197 9:68372407-68372429 TGCATCTTCCGTGATGGAAGTGG + Intronic
1054727253 9:68664911-68664933 TACTCCTGCCATGATGGAAGGGG - Intergenic
1055242221 9:74197952-74197974 TGCCCTTTCCGGGAGGGAGGTGG + Intergenic
1055517393 9:77047136-77047158 TTTCCTTTCCCTGAAGGAAGAGG + Intergenic
1055844956 9:80550658-80550680 TACCCTTTCCATGATGGAAGGGG - Intergenic
1055903792 9:81270169-81270191 TGCCCTTTCCATGACTGAGGAGG + Intergenic
1056156822 9:83846219-83846241 TGCCCTTTCTGTCATGGAAGAGG - Intronic
1056246704 9:84702641-84702663 TGCTCTGTCCAAGATGGAACTGG - Intronic
1056314085 9:85371920-85371942 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1056353713 9:85777307-85777329 TGCCCTTTCTGTGATGGAAGAGG + Intergenic
1057059131 9:91987565-91987587 TGTCCCTTCCATGATGGAAGTGG - Intergenic
1057100445 9:92354237-92354259 TGCCCTTTCCATTATGGAATAGG + Intronic
1057703104 9:97377748-97377770 TGCTTTTGCCTTGATGGAAGGGG - Intronic
1058020056 9:100077086-100077108 TGCCCTTTCCATGATAGAAGAGG - Intronic
1058124720 9:101178384-101178406 TGCTCTTTCCATGATGGAAGAGG - Intronic
1058259118 9:102808663-102808685 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1058907822 9:109495925-109495947 TGCCCTTTCCTGCACGGAAGTGG + Intronic
1059167508 9:112093154-112093176 TGCCTTTTCCCTTATGGAATTGG - Intronic
1059196357 9:112374842-112374864 TGCCTTTTCCATGATGGAAGAGG + Intergenic
1059470257 9:114499599-114499621 AGCCCTTTGCAGGATGGAGGGGG + Intronic
1060164159 9:121395291-121395313 TTTCATTTCCATGATGGAAGGGG + Intergenic
1060178934 9:121518322-121518344 TGCCCCTTCCATGATGGGAGAGG - Intergenic
1061877270 9:133550583-133550605 TTCCCCTTCCAGGATGGAAGGGG + Intronic
1062135624 9:134926033-134926055 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1186279656 X:7978142-7978164 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1186469616 X:9811111-9811133 TGCCCTTGCCATGATGGAAGAGG + Intronic
1186578979 X:10796760-10796782 TCCCCTTTCTATGCTTGAAGGGG + Intronic
1187524063 X:20038150-20038172 TGCCCTTTTCATGATGGAAGAGG - Intronic
1188222646 X:27559411-27559433 TGGCCTTTCCAGGTTAGAAGGGG + Intergenic
1188297141 X:28463316-28463338 TGAACTTACCATGAAGGAAGAGG - Intergenic
1188972951 X:36639496-36639518 TGCCCTTTGCAAGCTGGAAGGGG - Intergenic
1190113944 X:47613484-47613506 TGTTCTTTGCAGGATGGAAGGGG - Intronic
1190968367 X:55323837-55323859 TACCCTTTGCTTGAAGGAAGAGG - Intergenic
1191658652 X:63628784-63628806 TGCCTTTTCCATGATGGAAGAGG + Intergenic
1191719099 X:64214688-64214710 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1191759501 X:64630920-64630942 TGCCCTTTCCATGATGAAAGAGG - Intergenic
1191933056 X:66395168-66395190 TGCCCTTTCCATTATGGAAGAGG - Intergenic
1191941119 X:66482854-66482876 TGCTCTTTCCATGATGGAAGAGG + Intergenic
1191946495 X:66540044-66540066 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1192297568 X:69867004-69867026 TGCCCTTTCCATAATGGAAGAGG + Intronic
1192531565 X:71892144-71892166 TGCCCCTTCCATAATGGAAGTGG + Intergenic
1192661430 X:73046762-73046784 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1192673113 X:73167385-73167407 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1192824617 X:74682222-74682244 TGTCCCTTCTATGATAGAAGTGG - Intergenic
1193053635 X:77126791-77126813 TGCTCTTTCCATAATGGAAGAGG - Intergenic
1193187498 X:78530229-78530251 TGCCCTTTCCACAAGGAAAGTGG - Intergenic
1193297918 X:79853680-79853702 TGCCCTTTCCATGATGAAAGAGG - Intergenic
1193356393 X:80524164-80524186 TGCCCTTTCCATGATGGAAAAGG - Intergenic
1193447303 X:81619786-81619808 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1193531276 X:82657632-82657654 TGCCCCTTCCATAATGGAGATGG + Intergenic
1193573569 X:83174158-83174180 TGCCTTTTTCATGATGGGAGAGG + Intergenic
1193833094 X:86311130-86311152 TGTTCTTTCCATGATGGAAGAGG - Intronic
1193914673 X:87350922-87350944 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1193984269 X:88221045-88221067 TGCCCCTTCAATGATGAAAGTGG - Intergenic
1194108659 X:89803382-89803404 TTCCCTTTCCATGACTGAGGTGG + Intergenic
1194163814 X:90489135-90489157 TGGCCCTTCCATGATGGCAGTGG + Intergenic
1194174768 X:90631852-90631874 TGCCCTTTCTATTATAGAAGAGG - Intergenic
1194179461 X:90694914-90694936 TGCCCTTTCCATAATGGAAGAGG + Intergenic
1194210421 X:91063374-91063396 TGCCCTTTCCATGATGGAAAAGG - Intergenic
1194232997 X:91347308-91347330 TACCCTTTCCATGATGGAAGAGG - Intergenic
1194343457 X:92732107-92732129 TGCCCCTTCCATGATTGTAGAGG - Intergenic
1194443680 X:93962126-93962148 TGCCTTTTCCATGATGAATGAGG - Intergenic
1194453967 X:94079818-94079840 TCCCCTTTCCATGAAGGAAGAGG + Intergenic
1194457094 X:94118509-94118531 TGCCCTTTCCATAATGGAAGAGG - Intergenic
1194485248 X:94478335-94478357 TGCCCTTTCCATGATGGAAAAGG - Intergenic
1194513284 X:94821239-94821261 TGCTCTTTCCATGATGGAAGAGG + Intergenic
1194584258 X:95714083-95714105 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1194604366 X:95961741-95961763 TGCCTTTTTCATGATGAAAGAGG - Intergenic
1195068327 X:101256964-101256986 AGACCTTTCAATGTTGGAAGTGG + Intronic
1195097214 X:101514698-101514720 TGCCCCTTCCATGATGGTAGTGG + Intronic
1195539113 X:106042296-106042318 TACCCCTTCCAAGATGGAAGTGG - Intergenic
1195544888 X:106103068-106103090 TGCCCCTTCCGTGATGGAGGTGG - Intergenic
1195783937 X:108496000-108496022 TGCCTCTTCCATGGTAGAAGGGG - Intronic
1195809645 X:108815825-108815847 TACCCATTCCATGATGGAAGAGG + Intergenic
1196780286 X:119377398-119377420 TGGCCCTTCCAGGATGGAAGAGG - Intergenic
1197044561 X:121979332-121979354 TGCCCTTTCCATGATGGAAAAGG - Intergenic
1197182245 X:123548804-123548826 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1197244902 X:124157978-124158000 TGTACTTGCCATGATGGAAAAGG + Intronic
1197379864 X:125726869-125726891 TTCCCTTTCCATGATAAAAGAGG + Intergenic
1197386636 X:125811225-125811247 TGCCCTTTCTATGTTGTAAGAGG + Intergenic
1197409180 X:126095423-126095445 TGCCCTTTCCATGATAGAAGAGG + Intergenic
1197420022 X:126227355-126227377 TGCCTTTTCCATGATAAAAGAGG - Intergenic
1197537412 X:127707505-127707527 TGCACTTTCCATGATGGAAGAGG - Intergenic
1197592022 X:128420409-128420431 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1198186166 X:134256018-134256040 TGGCCCTTTCAGGATGGAAGGGG + Intergenic
1198266638 X:135015640-135015662 TTCCCTTTCCATGACATAAGAGG + Intergenic
1198330297 X:135616738-135616760 TGTCCCTTCCATAGTGGAAGTGG + Intergenic
1198336630 X:135672261-135672283 TGTCCCTTCCATAGTGGAAGTGG - Intergenic
1198363021 X:135914522-135914544 TGTCCCTTCCATAGTGGAAGTGG + Intergenic
1198934181 X:141888880-141888902 TGCCCTTTCCATGATGGAAGAGG - Intronic
1198959923 X:142173387-142173409 TGGCCTTTCCCTGATAGAAGTGG - Intergenic
1198963103 X:142203387-142203409 TGGCCTTGCCCTGATAGAAGTGG - Exonic
1199008636 X:142731972-142731994 TGCCCCTTTCATGATGGAAGTGG - Intergenic
1199013269 X:142781677-142781699 TGCCCCTTTCATGATGAATGCGG - Intergenic
1199024525 X:142920746-142920768 TGCCCTTTCCATGACGGAAGAGG - Intergenic
1199116434 X:143998244-143998266 TGCCCTTTCCATAATGAAAGAGG + Intergenic
1199310284 X:146313378-146313400 TGCCCTTTCTATGATGGAACAGG + Intergenic
1200340332 X:155389618-155389640 TGCCCCTTCCATGATGGAAGAGG + Intergenic
1200461317 Y:3458110-3458132 TTCCCTTTCCATGACTGAGGTGG + Intergenic
1200510077 Y:4066944-4066966 TGGCCCTTCCATGATGGCAGTGG + Intergenic
1200521413 Y:4213041-4213063 TGCCCTTTCTATTATGGAAGAGG - Intergenic
1200526125 Y:4277087-4277109 TGCCCTTTCCATAATGGAAGAGG + Intergenic
1200651811 Y:5848772-5848794 TGCCCCTTCCATGATTGAAGAGG - Intergenic
1200745913 Y:6903844-6903866 TGCTCTTTTCATGACGGAAGTGG + Intergenic
1200976744 Y:9219460-9219482 TTCCCTTTCCATAATGGAAGAGG - Intergenic
1202138081 Y:21687817-21687839 TGCCCTTTCCATGATGGAAGAGG - Intergenic