ID: 939069232

View in Genome Browser
Species Human (GRCh38)
Location 2:137518918-137518940
Sequence AACCTCTGCCCTTTCCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 820
Summary {0: 121, 1: 172, 2: 117, 3: 132, 4: 278}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939069232_939069240 4 Left 939069232 2:137518918-137518940 CCATCATGGAAAGGGCAGAGGTT 0: 121
1: 172
2: 117
3: 132
4: 278
Right 939069240 2:137518945-137518967 CTCACTGGAAAAGGGGAAAGGGG No data
939069232_939069236 -3 Left 939069232 2:137518918-137518940 CCATCATGGAAAGGGCAGAGGTT 0: 121
1: 172
2: 117
3: 132
4: 278
Right 939069236 2:137518938-137518960 GTTTGTCCTCACTGGAAAAGGGG No data
939069232_939069234 -5 Left 939069232 2:137518918-137518940 CCATCATGGAAAGGGCAGAGGTT 0: 121
1: 172
2: 117
3: 132
4: 278
Right 939069234 2:137518936-137518958 AGGTTTGTCCTCACTGGAAAAGG No data
939069232_939069241 8 Left 939069232 2:137518918-137518940 CCATCATGGAAAGGGCAGAGGTT 0: 121
1: 172
2: 117
3: 132
4: 278
Right 939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG No data
939069232_939069242 9 Left 939069232 2:137518918-137518940 CCATCATGGAAAGGGCAGAGGTT 0: 121
1: 172
2: 117
3: 132
4: 278
Right 939069242 2:137518950-137518972 TGGAAAAGGGGAAAGGGGCTGGG No data
939069232_939069243 14 Left 939069232 2:137518918-137518940 CCATCATGGAAAGGGCAGAGGTT 0: 121
1: 172
2: 117
3: 132
4: 278
Right 939069243 2:137518955-137518977 AAGGGGAAAGGGGCTGGGCACGG No data
939069232_939069244 17 Left 939069232 2:137518918-137518940 CCATCATGGAAAGGGCAGAGGTT 0: 121
1: 172
2: 117
3: 132
4: 278
Right 939069244 2:137518958-137518980 GGGAAAGGGGCTGGGCACGGTGG No data
939069232_939069237 2 Left 939069232 2:137518918-137518940 CCATCATGGAAAGGGCAGAGGTT 0: 121
1: 172
2: 117
3: 132
4: 278
Right 939069237 2:137518943-137518965 TCCTCACTGGAAAAGGGGAAAGG No data
939069232_939069239 3 Left 939069232 2:137518918-137518940 CCATCATGGAAAGGGCAGAGGTT 0: 121
1: 172
2: 117
3: 132
4: 278
Right 939069239 2:137518944-137518966 CCTCACTGGAAAAGGGGAAAGGG No data
939069232_939069235 -4 Left 939069232 2:137518918-137518940 CCATCATGGAAAGGGCAGAGGTT 0: 121
1: 172
2: 117
3: 132
4: 278
Right 939069235 2:137518937-137518959 GGTTTGTCCTCACTGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939069232 Original CRISPR AACCTCTGCCCTTTCCATGA TGG (reversed) Intronic
900099665 1:956311-956333 AACCTCTGCCCTATGTCTGAGGG - Intronic
901903765 1:12390617-12390639 AAACTCTGCCCTTTCCATGATGG + Intronic
902725845 1:18335369-18335391 ATCCTATGCCCTCTCCATTAAGG - Intronic
904179291 1:28654598-28654620 AACCTCTGCCCTTTCTGTGATGG + Intergenic
905354227 1:37369841-37369863 AACCTCTGCCCTTTCCATGATGG - Intergenic
905403433 1:37718526-37718548 AACTTCTGCTCCTCCCATGAAGG + Intronic
905465386 1:38149162-38149184 AACCTCTGCCCTTTCCATGATGG - Intergenic
905729678 1:40288379-40288401 AATCACTGCCCCTTCCATGAGGG + Intronic
906050643 1:42868468-42868490 AACCTCTGCCCTTTCCGTGATGG - Intergenic
906398600 1:45488535-45488557 AACCTGTGTTCTTTCCATTATGG - Intronic
906879806 1:49577513-49577535 AACCTCTGCTTTTTCCATGATGG - Intronic
906930768 1:50167466-50167488 AACCTCTGCCCTTTCCGTGATGG + Intronic
907154008 1:52315791-52315813 AATCTCTGCCTTTTACTTGAAGG - Intronic
907487533 1:54787957-54787979 CACCTCTGCCCTTACCCTGCTGG + Intronic
907597500 1:55733175-55733197 AACCTCTTCCCTTTCCATGATGG - Intergenic
907780488 1:57561894-57561916 AACCTCTGTCCTTTGTATAATGG - Intronic
907954542 1:59215620-59215642 AACCTCTGCCTTCTCCCAGAAGG + Intergenic
908052470 1:60247770-60247792 AACCTCTTCCCTTTCCATGATGG - Intergenic
908408152 1:63835115-63835137 AACCTGTGCTTTTTCCATTATGG - Intronic
908737542 1:67291872-67291894 AACCTCTGCCCTTTGCATGACGG - Intergenic
909032515 1:70559371-70559393 AACCACTGTCCTTTCCATGGGGG - Intergenic
909032736 1:70561237-70561259 AACCTCTGCCCTTTCCATGATGG + Intergenic
909172452 1:72314409-72314431 AACCTCTGCCCTTTCCATAATGG + Intergenic
909548798 1:76876139-76876161 AACCTCTGCCTTTTCCATGATGG + Intronic
909577081 1:77186912-77186934 AACCACTGCCCTTTTCGTGATGG - Intronic
909781365 1:79551349-79551371 AAGCGCTGCCCCTTCCCTGATGG - Intergenic
909858767 1:80575987-80576009 AACCGCTGCCTTTTCCATGTTGG + Intergenic
910588372 1:88902779-88902801 AACCTCTGCCCTTTCCATGATGG - Intergenic
910630368 1:89347323-89347345 AACCACTGCCCTCTTCATGATGG - Intergenic
910830944 1:91462362-91462384 AACCTCTGCCCTTTCCATGAAGG + Intergenic
910948364 1:92617767-92617789 AACCTCTGCCCTTTCCATGATGG - Intronic
911109015 1:94163644-94163666 AACCTCTTTCCTTTCCATGATGG + Intronic
911257185 1:95646303-95646325 CACCTCTTCCCTTTCCATGATGG + Intergenic
911883721 1:103271521-103271543 AACCTCTGCTCTTTCCATGATGG - Intergenic
912067165 1:105758011-105758033 AATCTCTGGCCTTTCCACAATGG - Intergenic
912129759 1:106586998-106587020 AACCTCTGCCCTTTCCATGATGG + Intergenic
912143565 1:106762396-106762418 AACCTATTCCCTTTGAATGATGG - Intergenic
912212402 1:107569919-107569941 AACTTCTGCCTTTTCCATGATGG - Intergenic
912251869 1:108020326-108020348 AACCTCTGCCCTTCCCATGATGG + Intergenic
912549509 1:110475854-110475876 AACCTCTGCCCAATGCATGATGG - Intergenic
912733173 1:112127774-112127796 AACCTCTGCTCTTTCCATGATGG + Intergenic
912943653 1:114067147-114067169 AACCTCTGCCCTTTCCATGATGG + Intergenic
913039293 1:115007337-115007359 AACTGCTGCTCTTTGCATGATGG + Intergenic
913340316 1:117752014-117752036 AACCTCCGCCCTGCCCAAGAGGG - Intergenic
913559308 1:120001641-120001663 AACATCTGCCCTTTTCACAATGG - Intronic
913638554 1:120788901-120788923 AACGTCTGCCCTTTTCACAATGG + Intergenic
914279904 1:146161084-146161106 AACATCTGCCCTTTTCACAATGG - Intronic
914540943 1:148612002-148612024 AACATCTGCCCTTTTCACAATGG - Intronic
914625698 1:149459244-149459266 AACATCTGCCCTTTTCACAATGG + Intergenic
915667525 1:157458614-157458636 AACATTTACCCTTTCCATGATGG + Intergenic
915680071 1:157572780-157572802 AATCATTGCCCTCTCCATGATGG - Intergenic
915709807 1:157884701-157884723 AACCTCTGCTTTTTCCATGATGG - Intronic
916089380 1:161295403-161295425 ACCCTCTGCCCCCTCCATGATGG - Intergenic
916106044 1:161433239-161433261 AAGCTTTGACTTTTCCATGATGG + Intergenic
916285482 1:163100578-163100600 ACTTTCTGCCCTTTCCATGATGG - Intergenic
916635146 1:166660232-166660254 AAACACTGCTCCTTCCATGATGG - Intergenic
917217067 1:172689848-172689870 AACCTCTGCCCTTTCCATGATGG + Intergenic
917283369 1:173399976-173399998 AAACACTGCCCCTTCCATGATGG - Intergenic
917462857 1:175247216-175247238 AAACTCTGCCCTTTCCATGATGG - Intergenic
917967042 1:180185438-180185460 AGCCTCCGGCCCTTCCATGAGGG + Intronic
918755564 1:188336754-188336776 AACCTCTGCGCTTTCCATGATGG + Intergenic
918774648 1:188611804-188611826 AACCTTTGCCCTTTTCATGATGG - Intergenic
918783319 1:188731484-188731506 AACTGCTGCCTTTTCCATGTTGG + Intergenic
918815203 1:189172281-189172303 AACTGCTGTCCTTTCCATGATGG - Intergenic
918918086 1:190670826-190670848 AACCTCTGCCCTTTCCATGATGG + Intergenic
919000587 1:191826817-191826839 AACCTCTGCCCTTTCCATGATGG + Intergenic
919124223 1:193376908-193376930 AACCGTTGCCCTTTCCATGATGG + Intergenic
919241916 1:194925256-194925278 AACCTCTGCCTTTTCCATGACGG - Intergenic
919318125 1:196000402-196000424 AACCTCTGCCCTTTCCATGATGG - Intergenic
919330357 1:196162986-196163008 AACCTCTTCCCTTTCCATGATGG - Intergenic
920197588 1:204239415-204239437 AACCTCTGCCCTTTCCATGATGG - Intronic
921569812 1:216764762-216764784 AACCTCTGATCATTCCAGGAGGG + Intronic
922466878 1:225850359-225850381 AACCTCTCGGCTTTCCAAGAAGG - Intronic
922780902 1:228251543-228251565 AACCATTGCCCTTTCTATGATGG + Intronic
923253422 1:232198389-232198411 AACCTCTGGCCTTTCCATGATGG + Intergenic
923926038 1:238628750-238628772 AAACACTGCCCTTTGCATGATGG + Intergenic
924840621 1:247706771-247706793 AATCTCTGCCCTTTCCAAGATGG + Intergenic
924846991 1:247784085-247784107 AACCTCTGCCATTTTCATGATGG + Intergenic
1063788277 10:9409564-9409586 GACCTCTGCCCTTTCCATGATGG - Intergenic
1065849797 10:29778243-29778265 TACTTCTCCCCTTTCCATAAAGG - Intergenic
1066169590 10:32827373-32827395 AACCTCTGCCCTTCCCATGATGG - Intronic
1066957767 10:42189115-42189137 AACCTCTCTCCTTTCCATGGTGG - Intergenic
1067125400 10:43511488-43511510 AACCTCTGTCCATTCCATGATGG + Intergenic
1067333295 10:45341278-45341300 AACCTCTGCCCTTTTCAGGATGG - Intergenic
1067754201 10:48992659-48992681 AATCTCTGCCCTTTCCATGATGG + Intergenic
1068007517 10:51408521-51408543 AACCTCTGCCCTTTCCTTGATGG + Intronic
1068447353 10:57139653-57139675 AACCTCTGCCCTTTCCATGATGG - Intergenic
1068705378 10:60070064-60070086 AACCCCTTCCCATTTCATGAAGG - Exonic
1068837063 10:61567321-61567343 AACCTCTGCCCTTTCCATGATGG + Intergenic
1069145906 10:64891484-64891506 AACCGCTGCCCTTTACATGATGG - Intergenic
1069192162 10:65505319-65505341 AATCTCTGTGCTTTCAATGATGG + Intergenic
1069519966 10:69111129-69111151 AATCTCTGGCCCTTCCATGATGG - Intergenic
1069790678 10:71018525-71018547 AACCTCTGCCCCTTTCATAATGG + Intergenic
1070815622 10:79321175-79321197 AATCACTGCCCTTCCCATGAGGG - Intergenic
1071032887 10:81205774-81205796 AACCACTGTCCTTTCCATGATGG - Intergenic
1071167869 10:82828004-82828026 AACCTCTGCCCCTACTCTGAAGG + Intronic
1071266923 10:83972945-83972967 AACCTCTGCCCTTTCCATGATGG + Intergenic
1071308659 10:84323111-84323133 AACTGCTGTCCTTTACATGATGG - Intergenic
1071364333 10:84883464-84883486 AACCCCTGCCCTTTACATGGTGG + Intergenic
1071378530 10:85034418-85034440 AACCTCTGCTCTTTCCATGATGG - Intergenic
1071863036 10:89695499-89695521 AACCACCGCCCTTCCCATCATGG - Intergenic
1071937840 10:90550336-90550358 AACCTCTGCCCTTTTCGTGATGG - Intergenic
1071942631 10:90606716-90606738 AACCTCTGCCCTTTCCATCATGG + Intergenic
1071946957 10:90656674-90656696 AAACACAGCCCTTTCTATGATGG + Intergenic
1072209113 10:93230648-93230670 AACCTCTGCCCTTTCCATGATGG + Intergenic
1072360610 10:94655145-94655167 AACCTCTGCCCTTTTCATGATGG - Intergenic
1073517541 10:104090663-104090685 AACTCCTGCCCTTCCCATGTGGG + Intergenic
1073550460 10:104395711-104395733 AAAATCTGCCCTTTCCCTCAGGG - Intronic
1073557504 10:104466952-104466974 AACATCTGCCCTTTCCATGATGG - Intergenic
1073656528 10:105423433-105423455 AACCTCTGCCCTTTCCATGATGG + Intergenic
1073957604 10:108891121-108891143 AACTGCTGCCTTTTCCATGATGG + Intergenic
1074589483 10:114799257-114799279 AACCTCTTCTCTTCCTATGAAGG + Intergenic
1075352898 10:121741425-121741447 AACCACTGTGCTTTCCTTGAGGG - Exonic
1076133643 10:128030070-128030092 AGCCTCTGCCGTTTCCAAAAAGG - Intronic
1076772465 10:132673779-132673801 AACCTCTGCCCTTCCCATGATGG + Intronic
1076927253 10:133498157-133498179 AATCTCTGCCCTTTCCATGATGG + Intergenic
1078195389 11:9132915-9132937 AACCGCTGGCCTTTCCAGAATGG - Intronic
1080076747 11:28158550-28158572 AACCTCTGCCCATTCCATGATGG - Intronic
1081065309 11:38533710-38533732 AACCTCTGCCCTTTCTATGATGG + Intergenic
1081110677 11:39129773-39129795 AACCTCTGTCCTTTCCATGATGG - Intergenic
1081375330 11:42351578-42351600 AATATTTGCCCTTTCCATGATGG - Intergenic
1081378439 11:42386962-42386984 AACCTCTGCCGTTTCCATGATGG - Intergenic
1081609216 11:44548918-44548940 AACCTCTGCCTTTTCCATGATGG - Intergenic
1082929901 11:58591792-58591814 AAGCACTGCCACTTCCATGATGG + Intronic
1082999807 11:59280904-59280926 AACCTCTGCCCTTTTCTTAATGG - Intergenic
1083093283 11:60222155-60222177 AACCGCTGCCCTTTCCGTGATGG - Intronic
1083222026 11:61258830-61258852 AGCTTCAGCACTTTCCATGATGG - Exonic
1083698236 11:64456886-64456908 AATCTCTGCCCTTTCCAGGGTGG - Intergenic
1084119879 11:67062759-67062781 ATCCTCTTCCCTTCCCATGCCGG - Intronic
1085243355 11:75076728-75076750 AACCACTGCCCTGTCAATAATGG + Intergenic
1085615962 11:77998975-77998997 AATCACTGCTCCTTCCATGATGG + Intergenic
1085684821 11:78611901-78611923 AAACACTGCCCCTTCCATGATGG - Intergenic
1085686110 11:78623220-78623242 AACCTCTGCCCTTTCCATGATGG - Intergenic
1085748479 11:79136607-79136629 AACCTCTGCCTTTTCCATGATGG - Intronic
1086141480 11:83505166-83505188 AACCTCTGCTCTTTCCGTGATGG + Intronic
1086278756 11:85161487-85161509 AACCTCTGCCTTTTCCATGATGG - Intronic
1086834268 11:91601419-91601441 AACAGCTGCCATTTCCATGATGG - Intergenic
1087374164 11:97321579-97321601 AATCTCTGTCCTTTCCATGATGG - Intergenic
1087613531 11:100462175-100462197 AATATCTTCCCTATCCATGATGG - Intergenic
1088202870 11:107359232-107359254 AAGCACTGCCCCTTCCAGGATGG - Intronic
1088264136 11:107973716-107973738 GATCTCTGCCCCTTCCATGATGG + Intergenic
1088407464 11:109497634-109497656 AACCTCTGCCCTTTCCATGATGG + Intergenic
1088836807 11:113584415-113584437 AACCTCTGCCCTTTCCATGATGG - Intergenic
1089339093 11:117745475-117745497 GCCCTCTGCCCTTCCCATGCAGG + Intronic
1089903766 11:122014646-122014668 AACCTCTGCCCTTTCCATGATGG - Intergenic
1090119045 11:124005360-124005382 AACCTCTGTCCTTTCCATTATGG + Intergenic
1090197121 11:124826287-124826309 AACCTCTGCCCTTTCCACGATGG + Intergenic
1090209338 11:124907022-124907044 AACTGCTGCCCTTTCCATGATGG + Intergenic
1090221459 11:125030563-125030585 AACCTCTGCCCTTTACATGATGG + Intronic
1090857787 11:130625385-130625407 AACTGCTGCGCTTTCCATCAAGG + Intergenic
1091051897 11:132379789-132379811 AACCTCTGCCCTTTCCATGATGG - Intergenic
1091279374 11:134373421-134373443 AACCTCTGGCCTCTCTCTGAAGG - Intronic
1092012293 12:5124568-5124590 TAACACTGCCCCTTCCATGATGG + Intergenic
1092093435 12:5822669-5822691 AACCTCTGCCCTTTCCATGATGG - Intronic
1092381698 12:8001958-8001980 AACCTCTGCCTTTTCCATGATGG - Intergenic
1093031711 12:14294900-14294922 AACCTCTGCCCTTTCCATGATGG + Intergenic
1093036498 12:14336711-14336733 AACCTCTGCCCTTTCCATGATGG - Intergenic
1093048786 12:14484039-14484061 AACCTCTTCCCTTTCCATGATGG + Intronic
1093049521 12:14489937-14489959 AACCTCTTCCCTTTCCATGATGG + Intronic
1093645866 12:21584693-21584715 AGCCTCTGCCCTTTCCATGATGG - Intronic
1093832552 12:23781237-23781259 AACCTCTGCTGTTACCATGGAGG + Intronic
1093964685 12:25311966-25311988 AACCTCTGCCCTTTCCATGATGG - Intergenic
1094389638 12:29935189-29935211 AACCTCTGCCCTTTCCGTGATGG + Intergenic
1095121363 12:38423804-38423826 AACCCCTGCCATTTCCATGATGG + Intergenic
1095734972 12:45546895-45546917 AACCACTGGCCCTTCCAGGATGG + Intergenic
1095844234 12:46728940-46728962 AACCTCTGCCCTTTCCATGATGG + Intergenic
1095856103 12:46862641-46862663 AACCTCTGCCCTTTCCATGATGG + Intergenic
1096164387 12:49409251-49409273 CACCTCTCCACTTTGCATGATGG - Intronic
1096288924 12:50324285-50324307 AACCTCTGCCCTTCCTATGATGG - Intergenic
1096457308 12:51798413-51798435 AACCGCTGCCCTTTCCATGATGG + Intronic
1097077145 12:56403430-56403452 AACCTGTGCCCTTTCCATGATGG - Intergenic
1097437680 12:59571229-59571251 AACCTCTGCCCTTCCCATGATGG + Intergenic
1097808168 12:63988387-63988409 AACCACTGCTCTTTGCCTGATGG + Intronic
1097821200 12:64130875-64130897 AACCTCTGCCCTTTTCATGATGG + Intronic
1097843197 12:64341717-64341739 AACCTCTGCCCTTTCCATGATGG + Intronic
1098209155 12:68144491-68144513 AAACTCTCCCCTCTCCATGATGG + Intergenic
1098673167 12:73255280-73255302 AACCTCTGTCCTTTCCATGATGG - Intergenic
1098716247 12:73830838-73830860 AACCTCTGCCCTTTCCATGATGG - Intergenic
1098731203 12:74038371-74038393 AACCTCTGTCCTTTCCATGATGG - Intergenic
1098749984 12:74280631-74280653 AACCTCTGCCCTTTTCATGATGG - Intergenic
1098831763 12:75372997-75373019 AATCACTGCCCTTTCCATGACGG + Intronic
1099183239 12:79491570-79491592 AACCTCTGCCCTTTCCATGATGG + Intergenic
1099348431 12:81533159-81533181 ATCCAATGCCCTTTCCATCATGG - Intronic
1099366078 12:81766415-81766437 AACCTCTGACCTTTCTATAATGG - Intergenic
1099379243 12:81935513-81935535 AACCTCTGCCATTTCCATGATGG + Intergenic
1099384368 12:81997159-81997181 AACCACTGCCCTTCTCAGGATGG - Intergenic
1099490525 12:83283217-83283239 AACCTCTGCCCTTTCCATGATGG + Intergenic
1099526505 12:83724114-83724136 TACCTCTTCCATTTTCATGATGG - Intergenic
1099526507 12:83724148-83724170 AACCTCTGCTATTTTCATGATGG - Intergenic
1099689926 12:85939056-85939078 AACCTCTGCCCTTTCTATGATGG - Intergenic
1099700738 12:86078515-86078537 CACTGCTGCCCTTTCCATGATGG + Intronic
1099804301 12:87498589-87498611 AAACACTGCCCCTTCCATGACGG + Intergenic
1100013138 12:89977486-89977508 AAAATCTGACCTTTCCAAGAGGG + Intergenic
1100083452 12:90879241-90879263 AATCTCTGTCCTTTCCATGATGG - Intergenic
1100240993 12:92710572-92710594 AACCTCTGCCCTTTTCATGATGG + Intergenic
1101264287 12:103067150-103067172 AACCTCTGCCCTTTCCATAATGG - Intergenic
1101534460 12:105604721-105604743 AACCTCTGCCCTTTTCATGATGG + Intergenic
1101543216 12:105683669-105683691 AACCTCTGCCCTTTTCTTGATGG - Intergenic
1101916821 12:108902357-108902379 ATGCCCTGCCATTTCCATGAGGG + Intergenic
1103035776 12:117655107-117655129 AACCTCTGCCCTTTCCATGATGG - Intronic
1103172095 12:118830084-118830106 ATCCTCTTCACTTTCCAGGATGG - Intergenic
1104147940 12:126053681-126053703 AACTGCTGCTCTTTCCATGATGG - Intergenic
1104272411 12:127293982-127294004 AACCTCTGCCTCTTCCTTGCTGG - Intergenic
1104710584 12:130982897-130982919 CACCTCTGCCCTTCCCTTGTTGG - Intronic
1104750097 12:131232939-131232961 AAGCTCTTCCCTTTCCCTGTTGG + Intergenic
1104782620 12:131431522-131431544 AAGCTCTTCCCTTTCCCTGTTGG - Intergenic
1105740269 13:23316215-23316237 AACCTCTGCCCTTCCCATGATGG - Intronic
1105852607 13:24349274-24349296 AACCTCTGCCCCTTCCATGCTGG + Intergenic
1106545267 13:30725618-30725640 AAGCACTGCCCCTTCCATGATGG - Intronic
1107177494 13:37416075-37416097 AACATCTCACCTTTCCAGGAAGG + Intergenic
1107983434 13:45754936-45754958 AACTTCTGCCATTTCCATGATGG + Intergenic
1108904424 13:55450992-55451014 AACCTCTGCCTTTTCCATGATGG - Intergenic
1108914164 13:55587860-55587882 AATCTCTGTCCTTTCCATGATGG + Intergenic
1109293365 13:60501097-60501119 AACCTCTGCCCTTTCCATGATGG - Intronic
1109519176 13:63485836-63485858 AACCTCTGCCCTTTCCATGATGG - Intergenic
1109583188 13:64367202-64367224 AACTTCTGCCCTTTCCATGATGG - Intergenic
1109712538 13:66179799-66179821 AAGTGCTGCCCTTTCCATGAGGG + Intergenic
1109787188 13:67193253-67193275 AAGATCTTCCCTTTCCTTGAAGG + Intronic
1109950872 13:69501180-69501202 AACCTCTGCCCTTTCCATGATGG + Intergenic
1110377311 13:74807546-74807568 AACCTCTGCCCTTTCCATGATGG - Intergenic
1111016307 13:82386852-82386874 AACCTCTGCCCTTTCCATGGTGG + Intergenic
1111044509 13:82796947-82796969 TCACTCTGCCCATTCCATGATGG - Intergenic
1111057644 13:82971990-82972012 AACCTCAGCCCTTTCCATAATGG + Intergenic
1111275797 13:85945504-85945526 AAACTCTGCCTCTTCCATGATGG + Intergenic
1111535344 13:89596206-89596228 AACCTCTGCCCTTTCCCTGAGGG - Intergenic
1111959719 13:94796937-94796959 AAAATCTGCCTTTTCCATAATGG - Intergenic
1112230971 13:97589136-97589158 AACCCGTGCCCTTTCCATGATGG + Intergenic
1112249783 13:97769270-97769292 AACCTCTGCCCTTTCCATGATGG + Intergenic
1112981750 13:105393607-105393629 AAATACTTCCCTTTCCATGATGG + Intergenic
1113319552 13:109220639-109220661 AACTTCTGTCCTTTCCATGATGG + Intergenic
1113396282 13:109950567-109950589 AATCTCTGCCCTGTCCAAGATGG - Intergenic
1113508089 13:110830915-110830937 CACCTCTGCCCTTTCCGGGAGGG + Intergenic
1113523620 13:110957137-110957159 AACCTCTGGCCTGTACATGAAGG - Intergenic
1114206014 14:20571802-20571824 AACTTTTGCCCTTTCCATGATGG - Intergenic
1114758103 14:25282845-25282867 AACCTCTTTCCTTTCTATGATGG + Intergenic
1114905245 14:27119522-27119544 AACCTCTGCCCTTTCCATGATGG + Intergenic
1115059853 14:29174917-29174939 AACCTCTGCCCTTTCCATGATGG - Intergenic
1116101396 14:40441724-40441746 AAACACTGCCCCTTCCATGATGG + Intergenic
1116158233 14:41235624-41235646 AACCTCTGCCCTTTCCATGATGG + Intergenic
1116218662 14:42053560-42053582 AATCTCTGCCCTTTCCATGATGG - Intergenic
1116307919 14:43282425-43282447 AACTGCTGCCCCTTCCATGATGG + Intergenic
1116531317 14:45977206-45977228 GATCACTGCCCTTTTCATGAAGG + Intergenic
1117585083 14:57193206-57193228 AACCTCTGCTCATGCTATGAAGG + Intergenic
1117596122 14:57328849-57328871 AACCTCTGCCCTTTCCATGATGG + Intergenic
1117634287 14:57725410-57725432 AACCTCTACCCTTTCCATGTTGG - Intronic
1118122287 14:62859144-62859166 AACCTCTGCCCTTTCCATGATGG + Intronic
1118385160 14:65250233-65250255 AAATGCTGCCCTTTCCATAATGG + Intergenic
1118501975 14:66370419-66370441 AAATGCTGCCCCTTCCATGATGG - Intergenic
1118880625 14:69822985-69823007 AATTTCTGCCCTTTCTATGATGG + Intergenic
1119059553 14:71461161-71461183 AACCTCTGCCCTTTCCGTGATGG + Intronic
1119107405 14:71937808-71937830 AACCTCTGCCCTTTCCATGATGG + Intronic
1119453432 14:74733018-74733040 AGCCTGTGCTCTTTCCATTATGG - Intronic
1120081866 14:80226500-80226522 AACCTGTGCCCTTCCCATGATGG + Intronic
1120231295 14:81844208-81844230 AATCACTGCCCTTTCCATGATGG + Intergenic
1120844473 14:89113947-89113969 AATTTATGCCATTTCCATGATGG - Intergenic
1121061714 14:90916226-90916248 AAGCTCCATCCTTTCCATGATGG + Intronic
1122500747 14:102197703-102197725 AACCTTTGGCCTTTTAATGAAGG + Intronic
1122841292 14:104465025-104465047 AACCTCTGCCCCTTCCATGCTGG + Intergenic
1123128263 14:105965252-105965274 AACCTCTGCCCTTTCCAGGATGG - Intergenic
1202935337 14_KI270725v1_random:82661-82683 AACCTCTCTCCTTTCCATGGTGG + Intergenic
1123408789 15:20041409-20041431 AACCTCTGCCCTTTCCAGGATGG - Intergenic
1123518120 15:21048119-21048141 AACCTCTGCCCTTTCCAGGATGG - Intergenic
1123878073 15:24644940-24644962 AAACTCTGTCCCTTCCATGATGG + Intergenic
1123908354 15:24942671-24942693 AAACACTGGCCCTTCCATGATGG + Intronic
1123978335 15:25574159-25574181 AAACACTGCCCTTTCCATGATGG + Intergenic
1125535370 15:40439088-40439110 AACCTCTGTCCTGTCCAGGAAGG + Intergenic
1126283749 15:46987289-46987311 AACCACTGCCCTTTCCATGATGG - Intergenic
1126385070 15:48085853-48085875 AACCTCTTCCCTTTGCAAAATGG - Intergenic
1127688101 15:61368187-61368209 CAGCTCTGCTCCTTCCATGATGG - Intergenic
1127949439 15:63790112-63790134 AACCTCTATCATTGCCATGAGGG + Intronic
1128642951 15:69353261-69353283 AAACACTGCCTCTTCCATGATGG - Intronic
1129029873 15:72610372-72610394 AACCTCCGCCCCATCCAAGAAGG + Intergenic
1129475748 15:75783706-75783728 AACCTCTGCCCCATCCAAGAAGG + Intergenic
1130374063 15:83312395-83312417 AACTTCTGTCTTTTCCCTGAGGG - Intergenic
1130736059 15:86550314-86550336 AACCTCTGCCTTTGGAATGAGGG - Intronic
1131654396 15:94440678-94440700 TAACTCTGGCCTTTCCATGAAGG + Intronic
1131724164 15:95203834-95203856 CACCATTGCCCTTTCGATGATGG - Intergenic
1132217749 15:100079666-100079688 AACCACTGCCGTTTCCATGATGG - Intronic
1132432878 15:101774913-101774935 AACCTCTGCCCCATCCAAGAAGG - Intergenic
1134703438 16:16284323-16284345 AACTCCTGCCCCATCCATGAGGG + Intronic
1134964105 16:18427791-18427813 AACTCCTGCCCCATCCATGAGGG - Intronic
1134968392 16:18510327-18510349 AACTCCTGCCCCATCCATGAGGG - Intronic
1136251094 16:29005603-29005625 AACCTCTGCCTTTTCCATGATGG - Intergenic
1138342862 16:56302215-56302237 AACCACTGGCCTCTCCCTGAAGG + Intronic
1138661926 16:58525444-58525466 AATGTTTGGCCTTTCCATGAAGG - Intronic
1138827458 16:60337696-60337718 AACATCTGTCCTTTCCATGAAGG + Intergenic
1138868526 16:60851818-60851840 AACCTCTGCCTTTTCCATGATGG - Intergenic
1140849157 16:78918377-78918399 AACCTCTCTCCTTTCCAGGCTGG + Intronic
1141559393 16:84857004-84857026 AACCTCTGCACTTTCTGTGATGG + Intronic
1146238128 17:31186974-31186996 AATCTCTGCCCTTTCCGTGATGG - Intronic
1146758584 17:35455166-35455188 AACCTCCGCCATTTCCATGATGG - Intergenic
1146836508 17:36115009-36115031 AACCTCTGCCCTTTCCATGATGG - Intergenic
1146851086 17:36222068-36222090 AACCTCTGCCCTTTCCATGATGG - Intronic
1147168003 17:38603583-38603605 TTCTTCTGCCCTTTCCACGATGG - Intronic
1148109428 17:45136407-45136429 CACCTCTGCCCTTTCCAAGCAGG + Intronic
1149255028 17:54816468-54816490 AACCTCTGCCCTTTCCATGATGG - Intergenic
1151037652 17:70820572-70820594 AACCTCTGCTCTTTCCATGTTGG + Intergenic
1151194493 17:72421889-72421911 AGCCTCTGCCCTTCCCGAGAGGG - Intergenic
1151225364 17:72643916-72643938 AATCACTGCCCTTTCCATAATGG - Intergenic
1153089864 18:1331194-1331216 AACCTCTGTCCTTTCCATGATGG - Intergenic
1153131127 18:1856691-1856713 AACCTCTTCCATTTCCTTGATGG + Intergenic
1153217535 18:2834571-2834593 AACCTCTGCCCTTTCCATGATGG + Intergenic
1154068617 18:11132114-11132136 AATCTCTCCTCTTTCCATGTTGG - Intronic
1154252406 18:12755652-12755674 AACCTCTGCCCTTTCCATGATGG + Intergenic
1154506304 18:15043920-15043942 AACCTCTGCTCTTTCCATGAGGG - Intergenic
1156118584 18:33816746-33816768 AAACACTGCCCTTTCCATGGTGG - Intergenic
1156304005 18:35859726-35859748 AACCTCTGCCCTTTCCATGATGG - Intergenic
1156606517 18:38672783-38672805 AACCTCTGCCCTTTCCATGATGG - Intergenic
1156637118 18:39044838-39044860 AACTTCTGCACTTTTCATGCAGG - Intergenic
1156967083 18:43107348-43107370 AGCCTCTGCCCTGTCCACCAGGG - Intronic
1156990162 18:43399745-43399767 AACCTTTGCCTTTTCCATGATGG + Intergenic
1156998723 18:43498760-43498782 AACCTCTGCCCTTTCCATGATGG - Intergenic
1157341354 18:46781043-46781065 AACTTCTGCCCTTTTCATAATGG - Intergenic
1157846183 18:51006030-51006052 AACTGCTGCCCCTTCCACGATGG - Intronic
1157866840 18:51195626-51195648 AACATCTGCCCCTTTCATAAAGG + Intronic
1157870788 18:51228564-51228586 AACCACTGCCCTTTCCATGATGG + Intergenic
1158734918 18:60068705-60068727 AACCTCTGTACTTTACAGGATGG + Intergenic
1159151754 18:64531664-64531686 AACTGCTGCCCTTTCCATGATGG + Intergenic
1159277248 18:66236526-66236548 AAACACTGCCCCTTCAATGATGG - Intergenic
1159287926 18:66376505-66376527 AACCTCTGCCCATTCCATAATGG - Intergenic
1159558953 18:69974332-69974354 AACCTCTGGCCTTTCCATGATGG + Intergenic
1160092595 18:75841045-75841067 AACCACTGCCCTTTCTGTGATGG - Intergenic
1161284201 19:3460354-3460376 CACCTCTGCCGCTTCCATGCTGG + Intronic
1162798631 19:13099244-13099266 GTCCACTGCCCTTTCCTTGACGG + Exonic
1163233074 19:16016733-16016755 AGCCTCTGCTCTTTCCATGCTGG - Intergenic
1163447862 19:17358051-17358073 AACCTCCTTCCTTGCCATGAGGG + Intronic
1165079110 19:33297732-33297754 TACCCTTGCCCTTTCCTTGAAGG + Intergenic
1165497481 19:36161969-36161991 AATCTTTGCCCTCTTCATGACGG + Intergenic
1165998453 19:39862555-39862577 AATCTGTCCCCTTCCCATGAGGG - Intergenic
1166213281 19:41320743-41320765 AGCCTCTGCCATTGCCAGGAGGG - Intronic
1167312572 19:48745683-48745705 ATTCTCTACCCTTTCCATCATGG + Exonic
1167951773 19:53033257-53033279 AACTGCTGCCCTTTCCATGATGG - Intergenic
1168539178 19:57196374-57196396 GACCTCTGCCCTTTCCATGATGG + Intronic
925105404 2:1286664-1286686 AACCTCTGCCCTTTCCATGATGG + Intronic
925280108 2:2677893-2677915 AACCTCTGCCCTTTCTATGATGG - Intergenic
925499252 2:4485899-4485921 AACCTCTGCCCTTCCCATGATGG + Intergenic
925669550 2:6296690-6296712 CAACTCTGCCCTTCCCAAGAAGG - Intergenic
925772596 2:7297984-7298006 AACCTCTGCCCGTTCCATGTTGG + Intergenic
926810249 2:16749673-16749695 AACCTCTGCCCTTTCCATGATGG + Intergenic
926813470 2:16777580-16777602 TACCTCTGCCTTTTTCATGCAGG - Intergenic
926826916 2:16914692-16914714 AACCTCTGTCCTTTCCTTGATGG - Intergenic
927008864 2:18880756-18880778 AACCTCTTCCCTTTCCATGATGG - Intergenic
927711992 2:25331905-25331927 AACCCATGCCCCCTCCATGAAGG + Intronic
929269680 2:39959766-39959788 AGCTGCTGCCCTTTCCTTGATGG + Intergenic
930295056 2:49544343-49544365 AACCTCTGCCCTGTCCATGATGG + Intergenic
930481019 2:51948223-51948245 AACCATTGCCCTTTCCATGATGG + Intergenic
930536474 2:52651234-52651256 AAGCTCTGCCCTTTCCACGATGG + Intergenic
930563721 2:52993691-52993713 AATCTTTGCCCTTTCCAGGATGG + Intergenic
930910284 2:56621896-56621918 AACCTTGGCCCTTTCCATGATGG - Intergenic
930975983 2:57461864-57461886 CACTTCTGCCCTTGCCAGGAGGG - Intergenic
932113908 2:69027291-69027313 AAACTCTGCCGTTTCCCTGGAGG - Intronic
932870544 2:75394053-75394075 AACCTCTGCCCCTTCCATGATGG + Intergenic
932975819 2:76598231-76598253 AACCTCTGCCCTTTCCTTGATGG - Intergenic
933157958 2:78994811-78994833 AACCTCTTCCCTTCCCCTGGTGG - Intergenic
933265545 2:80177344-80177366 AATTGCTGCCCTTTCCATGATGG + Intronic
933379540 2:81525380-81525402 TACCTCTGCCCTTTTCATATTGG - Intergenic
933504635 2:83161737-83161759 AACCTCTGCCCTTTCCATGATGG + Intergenic
933523788 2:83410086-83410108 ACCCTCTGCCATCTCAATGATGG - Intergenic
933997977 2:87683868-87683890 AGCCTCTGCACTCTCCATCAGGG + Intergenic
934305887 2:91821632-91821654 AACCTCTCTCCTTTCCATGGTGG - Intergenic
934327369 2:92031110-92031132 AACCTCTCTCCTTTCCATGGTGG + Intergenic
934465754 2:94261690-94261712 AACCTCTCTCCTTTCCATGGTGG + Intergenic
934574957 2:95394170-95394192 AACCTCTGCCTCTTCCATGATGG - Intergenic
934650057 2:96085531-96085553 ACCTTCTGCCCCTTGCATGACGG - Intergenic
935184094 2:100715929-100715951 AGCGTCTGCCCTTTCCATGATGG - Intergenic
935424961 2:102910304-102910326 AACCTCTTCCCTTTCTGTGATGG + Intergenic
935564152 2:104589225-104589247 AGTGTCTGCCCTTTCCATGATGG + Intergenic
935666443 2:105517066-105517088 CACCTCTTCCCTTTCTATCAGGG - Intergenic
936078080 2:109414460-109414482 AACTTCTGCTCTGACCATGATGG - Intronic
936078590 2:109417389-109417411 GACACCTGCCCTCTCCATGAAGG - Intronic
936295873 2:111266998-111267020 AGCCTCTGCACTCTCCATCAGGG - Intergenic
937213785 2:120297185-120297207 AACCTCAGACCTTTCCAGTAAGG + Intergenic
937217747 2:120323497-120323519 GAGCTCTGCCCTTTCCAGCATGG + Intergenic
937527246 2:122786650-122786672 CACATCTGCCATCTCCATGAGGG + Intergenic
937581916 2:123498117-123498139 AACCTGTGCCCTTTCCATGATGG + Intergenic
937765780 2:125659016-125659038 AACTGCTGCCCTTTTCATGATGG - Intergenic
937785057 2:125886696-125886718 AATCTCTGCTCTTTCCATGATGG + Intergenic
937841104 2:126525526-126525548 AAGCACTGCCCTTTCTGTGATGG + Intergenic
937852423 2:126647703-126647725 AATTTCTGCCCTTTCCATGATGG + Intergenic
938201003 2:129373124-129373146 AACCTCAGGTCTTTCCATCAGGG + Intergenic
938724723 2:134097260-134097282 AACCTCTGCACTTTCCCTTGTGG - Intergenic
939069232 2:137518918-137518940 AACCTCTGCCCTTTCCATGATGG - Intronic
939083894 2:137694381-137694403 ATCCTCTGGGCCTTCCATGAGGG - Intergenic
939214014 2:139213269-139213291 AACCTCTGCTGTTTCTATGATGG - Intergenic
940171160 2:150831682-150831704 AACCTCTGCCCTTTCCAAGATGG + Intergenic
940283453 2:152010722-152010744 AGCCTGGGCCCCTTCCATGAGGG + Intronic
940471945 2:154112088-154112110 AACCTCTGCCCTTTCCATGATGG + Intronic
940605778 2:155923256-155923278 AACCTCTGCCCTTTCCACGATGG + Intergenic
941033405 2:160538786-160538808 AATCTCTGACCCTTCCAGGATGG + Intergenic
941509589 2:166389180-166389202 AACTTCTGACTTTTCCATGGTGG - Intergenic
941668168 2:168262129-168262151 AACCTCTGCCCTTTCCAACCAGG - Intergenic
943182239 2:184559655-184559677 AACCACTATCCTTTCCATGATGG - Intergenic
943317778 2:186411294-186411316 AACCTCTGCACTTTCCATGATGG + Intergenic
943383919 2:187180061-187180083 AACCACTGCCCTTTCCATGATGG + Intergenic
943517443 2:188906224-188906246 AACCTCTGCCCTTTCCATGATGG + Intergenic
943833469 2:192490125-192490147 AATCTCTGCCCTTTCCATGATGG + Intergenic
945545007 2:211139141-211139163 AACCTCTGCCCTTTCCATGATGG - Intergenic
945642331 2:212444869-212444891 AACCTCTGCCCTTTCCATGATGG - Intronic
945717688 2:213379638-213379660 AACCTCTGCCCTTTCCATGATGG + Intronic
945725699 2:213470470-213470492 AATCTCTGCCCCTTCCTTGATGG + Intronic
946004621 2:216512994-216513016 AACTGCTGCCCTTTGCATGATGG - Intronic
946527719 2:220538999-220539021 AACCTCTGCCTTTTCCATGATGG + Intergenic
946533959 2:220606829-220606851 AACTGGTGCCCTTTACATGATGG + Intergenic
946791055 2:223300784-223300806 AACCACTTCACTTTCCATGATGG - Intergenic
947440994 2:230121285-230121307 AACCTCTACCCTTTTCATGATGG - Intergenic
1168952662 20:1813049-1813071 AAGCTCTGCTCTTTTCATTAAGG - Intergenic
1169058437 20:2642655-2642677 AGGCTCTGCCCTTGCCATCAAGG - Intergenic
1169157664 20:3346908-3346930 AACCTCTCTTCTTTCCTTGAGGG - Intronic
1169626702 20:7579292-7579314 AAACACTGCCCCTTCCATGATGG + Intergenic
1173829555 20:46072526-46072548 AACCTCTACCAATGCCATGAAGG + Intronic
1175719831 20:61279373-61279395 AACCTCGGCCTTTTCCCAGAGGG + Intronic
1175752635 20:61509600-61509622 CACCTCTGGCCTTGGCATGACGG - Intronic
1175848579 20:62073587-62073609 AACCACAGCCCTTTCCATGGTGG - Intergenic
1176596757 21:8704897-8704919 AACCTCTCTCCTTTCCATGGTGG + Intergenic
1176791549 21:13325103-13325125 AACCTCTGCTCTTTCCATGAGGG + Intergenic
1176998315 21:15581299-15581321 AACCTCTTCCTTTTCCATGATGG - Intergenic
1177139269 21:17341233-17341255 AACCACTTCCCTTTCCATGATGG + Intergenic
1177361806 21:20082886-20082908 AACCTTTGTCCTTTCCATTTGGG + Intergenic
1177505415 21:22013173-22013195 AGGCTCTGCCCTTTCCATGATGG + Intergenic
1177913326 21:27057241-27057263 AACCTCTGCCCTTTCCATGATGG - Intergenic
1177990239 21:28028212-28028234 AACCTCTGCTCTTCCCATGAGGG - Intergenic
1178005894 21:28219401-28219423 AACCTCTGCCCTTTCCATGATGG + Intergenic
1178012811 21:28306208-28306230 AACCTCTGCCCTTTGCATGATGG - Intergenic
1178489865 21:33042632-33042654 AACCTCTGTGCCTTCCCTGAAGG + Intergenic
1179414993 21:41191505-41191527 AACCTCTGCCCTTTCCATGATGG + Intronic
1180279677 22:10682339-10682361 AACCTCTCTCCTTTCCATGGTGG + Intergenic
1180586893 22:16900869-16900891 AACCTCTCTCCTTTCCATGGTGG + Intergenic
1180590999 22:16937335-16937357 AACCTCTGCCCTTTCCATGATGG + Intergenic
1181367158 22:22386844-22386866 AACCTCTGCCCTTCCTGTGATGG + Intergenic
1181373566 22:22438131-22438153 AACCTATGCCCTTCTCATAATGG + Intergenic
1181572694 22:23776286-23776308 CAGCTCTGCCCTTTCCAGGGAGG + Intronic
1182965858 22:34520330-34520352 AACCTCTGCCCTTTCCATGATGG - Intergenic
1182989283 22:34751670-34751692 AACATCTGCCCATTTCATCAGGG + Intergenic
1183365837 22:37406448-37406470 GCTCTCTGCCCTTTCCCTGATGG - Intronic
1183479767 22:38057158-38057180 AAACCCTGCCCTTCCCAAGATGG + Intronic
1184603411 22:45557334-45557356 AACCTCTGCCATTTCCATGATGG + Intronic
1185304156 22:50103361-50103383 ACCCTCTGCCATTTGGATGAAGG + Intronic
949125312 3:440206-440228 AACCTCTGCCCTTTCCATGATGG + Intergenic
949125517 3:442080-442102 AACCTCTGCCATTTCTATGATGG + Intergenic
949169888 3:985569-985591 TTCCAGTGCCCTTTCCATGATGG + Intergenic
949417433 3:3829868-3829890 AACCTCTGCCCTTTTCATGATGG + Intronic
949445765 3:4132090-4132112 AACCTCTGCCCTTTCCATGATGG - Intronic
949501419 3:4683701-4683723 AAGCTCTGACTTTTCCACGATGG - Exonic
949851282 3:8422884-8422906 AAACACTGCCCTTTCCCTCAGGG + Intergenic
951003716 3:17593518-17593540 AACCTCTGCCCTTTCCATCGTGG - Intronic
951086699 3:18520294-18520316 AACTTCTGCACTTTCCATAATGG - Intergenic
951291373 3:20875711-20875733 AACCTTTACCCTTTCCATGATGG + Intergenic
951384667 3:22028550-22028572 AACCTCTACCCTTTCCGTGATGG - Intronic
951437361 3:22680152-22680174 AACCCCTGCCCTGTCCATTCAGG + Intergenic
952146502 3:30538531-30538553 AATCTCTGGTTTTTCCATGATGG + Intergenic
953805002 3:46061179-46061201 AAACACTGCCTCTTCCATGATGG + Intergenic
954054312 3:48008970-48008992 ATCCTCTGCCCTTTCCATGATGG - Intronic
954440367 3:50518437-50518459 AATCTCTGCCCCTTCCATGAGGG - Intergenic
954887586 3:53890048-53890070 CACCTCTACCCACTCCATGAGGG + Intronic
955888944 3:63630372-63630394 AACCTCTGCACTATCGATAAAGG - Intergenic
956509817 3:69981397-69981419 AACCTCTGCCCTTTCAATGATGG - Intergenic
957247423 3:77732868-77732890 AACTTCTGCCCTTTCCATGATGG + Intergenic
958487531 3:94731442-94731464 AACCTCTTCCCTTTCCATGATGG + Intergenic
958772586 3:98443581-98443603 AACCTCTGCCTTACCAATGAGGG + Intergenic
958845636 3:99261392-99261414 AACCTCTGCCCTTCCCATGATGG + Intergenic
959226632 3:103596249-103596271 AACCTCTGCTCTTTCCATGATGG + Intergenic
959377314 3:105602659-105602681 AACCTCTGCCTTTTGCATGATGG + Intergenic
959540060 3:107526118-107526140 AGCCTCTGCCCTTTCAATACGGG + Intronic
959598635 3:108154306-108154328 TCCCTCTGCCCTTTTCATGTGGG + Intergenic
959998020 3:112699351-112699373 AACCTCTGCCCTTTCCATGATGG - Intergenic
960494591 3:118359725-118359747 AACTTCTGCCCTTTCCATGATGG + Intergenic
961710831 3:128826987-128827009 ATCCTCTGCCTTTTCCATGATGG + Intergenic
962266067 3:133945138-133945160 TACCTCTCCCCTTGCCATGCCGG - Exonic
962281513 3:134055557-134055579 CAGCTCTGCCCTTTCAAAGATGG + Intergenic
963331655 3:143922342-143922364 ACCCTTTGCCCTTTCTGTGATGG + Intergenic
963379093 3:144506252-144506274 AACCTCTGCTCTTTCCATGATGG + Intergenic
963465036 3:145668708-145668730 AAATTCTGCCCATTCCATAATGG - Intergenic
963630454 3:147724251-147724273 AAGCTCTGCCCTTTCTATGATGG - Intergenic
963648614 3:147947787-147947809 AACATCTGCCATTTCAAAGAAGG - Intergenic
963661535 3:148133169-148133191 AACCGCTGCCATGTGCATGATGG - Intergenic
963885544 3:150577715-150577737 AAAATCTGCCCTTTCTAGGATGG - Intronic
963970167 3:151420922-151420944 AACCTCTGCCATTTCCATGGTGG + Intronic
964679083 3:159317882-159317904 AACCTCTGCCCTTTCCATGATGG + Intronic
964806114 3:160611392-160611414 AACTGCTGCCCTCTCCATGATGG - Intergenic
965034850 3:163424902-163424924 AACCTCTGCCTTTTCCGTGATGG + Intergenic
965226611 3:165999739-165999761 AACCTCTGCCCTTTCCATGATGG + Intergenic
965291600 3:166888560-166888582 AACATCTGCCCTTTCTATGATGG + Intergenic
966044181 3:175529888-175529910 AACCTCTGCCCTTTCCATAATGG + Intronic
966344232 3:178960738-178960760 AAATTCTGCCTTTTCCCTGAGGG + Intergenic
966445836 3:179999591-179999613 AACCTCTGCCCTTTCTATGATGG - Intronic
967235092 3:187376504-187376526 AATCACTACCCTCTCCATGATGG + Intergenic
967831940 3:193927012-193927034 AACCTCTGCCCTTTCCATGATGG - Intergenic
968800338 4:2739162-2739184 AACCTCTGCCCTTTCCATGATGG - Intergenic
968907164 4:3459444-3459466 AACCTCTGCCCTTTCCAGGATGG - Intergenic
969760754 4:9179728-9179750 AGCCTCTGTGCTGTCCATGATGG + Intergenic
969873818 4:10121451-10121473 AACCCCCGCCCTTTCCACAAAGG + Intergenic
970524130 4:16914097-16914119 AAACACTGCCCCTTCCATGGTGG - Intergenic
970629435 4:17924534-17924556 AACTGTTGCCCTTTCCATGATGG - Intronic
970644929 4:18108938-18108960 AACCGCTGCCCTTTCCATGATGG + Intergenic
971100870 4:23465389-23465411 AACCTCTGCCCTTTCCATGGTGG + Intergenic
971126581 4:23761339-23761361 AACCACTGTCCTTTCCATGATGG - Intronic
971687237 4:29786056-29786078 AACCTCTGCCCTTTCCACGATGG + Intergenic
971817371 4:31506098-31506120 AACCTCTGCCCTTTCCATGATGG - Intergenic
971857514 4:32061823-32061845 AATCACTGCCCATACCATGATGG + Intergenic
972085365 4:35208117-35208139 AACTTCTGCCCTTTCCATGATGG - Intergenic
972201157 4:36716151-36716173 AACCTGTGCCCTTTCCATGATGG + Intergenic
972240772 4:37189285-37189307 AATCTGTGCCCCCTCCATGATGG - Intergenic
972970416 4:44567900-44567922 AAGCTCTGCTCTTTCTTTGAAGG - Intergenic
973092726 4:46158115-46158137 AACCTCCTCCCTTTCCAAGATGG - Intergenic
973103068 4:46295775-46295797 AACATCTGCCCTTTCCATGATGG - Intronic
973148931 4:46864065-46864087 AAGCACTGCCCTTTCCAACAAGG + Intronic
973651447 4:53000737-53000759 AACAAGTGCCCTTCCCATGAGGG - Intronic
974478907 4:62419860-62419882 AACCTCTGCCCTTTCCATGATGG + Intergenic
974564928 4:63569342-63569364 AACCACTGCCCTTTCCATGATGG - Intergenic
974644471 4:64673753-64673775 AGCCTCTGTCCTTTCCATGTTGG + Intergenic
974727370 4:65813570-65813592 AACTGCTGCCCTTTCCATGATGG - Intergenic
974746786 4:66087956-66087978 GACCTCTGCCCTTTCCATGATGG + Intergenic
975386577 4:73766481-73766503 AACTGCTGCTCTTTCCGTGATGG + Intergenic
975982457 4:80176246-80176268 AACCTCTGCTCTTTCTATGATGG + Intergenic
976301199 4:83517120-83517142 AAATGCTGCCCCTTCCATGATGG + Intronic
976516187 4:85970089-85970111 AACCTCAGTCCTTACCCTGAAGG + Intronic
976725100 4:88208358-88208380 AAGCTCTCGCCTTCCCATGAAGG + Intronic
977089338 4:92651199-92651221 AAACACTGCCCCTTCCATGATGG + Intronic
977204858 4:94156666-94156688 AACTGCTGCCCCTTCCATGACGG - Intergenic
977430916 4:96929239-96929261 AACCTCTGCCCTTTCCATGATGG - Intergenic
977466154 4:97384407-97384429 AACCTCTGCCCTTTCCATGATGG - Intronic
977701598 4:100028854-100028876 AACCTCTGCCCTTTCCGTGATGG + Intergenic
977898857 4:102395617-102395639 AACCTCTGTCCTTTCCATGATGG - Intronic
978772006 4:112466756-112466778 AACCTCTGCCATTTCCATGATGG + Intergenic
979200681 4:117974343-117974365 AACCTTGGACCTTGCCATGAAGG + Intergenic
979304121 4:119122536-119122558 AGTATCTGCCCTTTACATGAGGG - Intergenic
979507419 4:121514269-121514291 AACCTCTGCCCTTTCAATGATGG + Intergenic
979888426 4:126061150-126061172 AACCACTGCCCTTTCCATGATGG + Intergenic
980385650 4:132086028-132086050 AAGTGCTGCCCTTTTCATGATGG + Intergenic
980629661 4:135415294-135415316 AACCTGTACCCTTTCCATGATGG - Intergenic
981462959 4:145032825-145032847 AACCTCTGCCGTTTCCATGATGG - Intronic
981835150 4:149044970-149044992 ATCCTCTGCCCTTTCCATGATGG - Intergenic
981873685 4:149516229-149516251 AACCTCTGCCTTTTCCATGATGG - Intergenic
982597628 4:157406022-157406044 AACCGCTGACCTTTCCATAATGG + Intergenic
982835698 4:160117677-160117699 AACCTCTGCCCTTTCCATGATGG - Intergenic
982850926 4:160315616-160315638 AAAAATTGCCCTTTCCATGATGG + Intergenic
983027552 4:162756320-162756342 AACCTCTGCCCTTTCCATGATGG - Intergenic
984060136 4:174980996-174981018 AACCTCTACTCTTCCCATGATGG + Intergenic
985676647 5:1234878-1234900 ATCCTCAGACTTTTCCATGAGGG + Intronic
986087248 5:4463749-4463771 AACCTCTGCCCTTTTCATGACGG - Intergenic
986261487 5:6151492-6151514 AACCTCTGCTCTTTCCATGATGG + Intergenic
986301188 5:6479565-6479587 AGCCTCTGCCCTTTTTATGATGG - Intronic
986531252 5:8739286-8739308 AATCTCTGCCCTTTCCATGATGG + Intergenic
986766310 5:10931336-10931358 AACCTCTGCCCTTTCCATGGTGG - Intergenic
986938192 5:12917720-12917742 AACCTCTGCCCTTTCCATGATGG + Intergenic
986959981 5:13200214-13200236 AACCACTGCCCTTTCCATGATGG - Intergenic
987153333 5:15062696-15062718 AACCTCTGCCATATCCATGATGG - Intergenic
987490687 5:18577287-18577309 AAGAACTGCCCTTTCCATGGTGG + Intergenic
987504537 5:18750869-18750891 AGCCTCTACCCTTTCCATGATGG - Intergenic
987578194 5:19757279-19757301 AACCTCTGACCTTTCCATGATGG + Intronic
988107906 5:26773574-26773596 AACCCCTGCCCTTTCTATGATGG - Intergenic
988169062 5:27631806-27631828 AACTTCTGCCCTTTCCATGATGG + Intergenic
988188930 5:27902274-27902296 AACCTCTGCCCTTTCCATGATGG - Intergenic
988205152 5:28124321-28124343 AACCTCTGCCCTTTCCATGATGG + Intergenic
988228901 5:28449157-28449179 AACCTTTGCCCTTTCCATAACGG - Intergenic
988785374 5:34561882-34561904 AACCTCTGCCCTTTCCATGATGG + Intergenic
989457497 5:41660736-41660758 AACCTCTGCCCTTTCCATGATGG + Intergenic
989486238 5:41995328-41995350 AACCTCTGCCCTTTCTATGATGG + Intergenic
990286668 5:54307119-54307141 AACTTTTCCCCTTTCCATGATGG - Intronic
990489941 5:56294824-56294846 AAGGTCTGCCATCTCCATGAGGG + Intergenic
990671516 5:58135681-58135703 AAACTCTGTCCTTTCTGTGATGG - Intergenic
991013641 5:61909860-61909882 AACCTCTGCCCTTTCATTGATGG + Intergenic
991013673 5:61910052-61910074 AACCTCTGCCCCTGCCACCATGG + Intergenic
991033700 5:62106951-62106973 AACCTCTGCCCTTTCATTGATGG - Intergenic
991330590 5:65488650-65488672 AACCGCTGCCCTTTCCATGATGG + Intergenic
991946296 5:71901156-71901178 AACCTCTGCCCTTTCCATGATGG - Intergenic
993203541 5:84848575-84848597 AACCACTGCCCTTTCCATGATGG - Intergenic
993319970 5:86459603-86459625 AACCTCTGCCCTTTCCATGATGG - Intergenic
993367323 5:87049932-87049954 AACCTCTGCCCTTGCTATGATGG + Intergenic
993412427 5:87590787-87590809 AACTTCTGCTCTTTCCATGATGG + Intergenic
993780822 5:92063422-92063444 AACCTCTGCCCTTTCCATGATGG - Intergenic
993791925 5:92219939-92219961 AACCTCTACCCTTTCCATGATGG - Intergenic
993840703 5:92875664-92875686 GTCCTCTGGGCTTTCCATGAAGG + Intergenic
994291217 5:98030922-98030944 AACCTCTGCCCTTTCCATGATGG + Intergenic
994386314 5:99137130-99137152 CACCTCATCCCTTTCCATAATGG + Intergenic
995269416 5:110204448-110204470 AACCTCTTCCCTATCCAGGATGG + Intergenic
995776134 5:115726677-115726699 AACCTCTGCCCTTTCCATGATGG + Intergenic
996018705 5:118568902-118568924 AACTGCTGCCCTTTCTATGATGG - Intergenic
996164820 5:120211484-120211506 AGCTGCTGCCCTTTCCATGATGG + Intergenic
996381582 5:122867394-122867416 AAACTCTGCCCCTTTCATGATGG + Intronic
996392057 5:122972758-122972780 AACCTCTGCCTTTTCCATGATGG + Intronic
996674696 5:126160658-126160680 ACCCTCTTCCATTTCCTTGATGG + Intergenic
998290182 5:140907521-140907543 AATCGCTGCCCTTTCTATGATGG + Intronic
998646988 5:144072958-144072980 AACCGTTGCCCTCTCCCTGAGGG - Intergenic
999351523 5:150875864-150875886 AATTGCTGTCCTTTCCATGATGG - Intronic
1000043627 5:157503600-157503622 AATTTCTGCCCATTGCATGAGGG + Intronic
1000417122 5:160994933-160994955 AACCTCTGCCCTTTCCATGATGG - Intergenic
1000422724 5:161056839-161056861 AAACACTGCCTCTTCCATGATGG + Intergenic
1001544610 5:172563336-172563358 ACCCTCTGCCCTGTCAATGCTGG - Intergenic
1001967832 5:175924931-175924953 GTACTCTGCCGTTTCCATGAGGG - Intronic
1002249614 5:177918871-177918893 ATACTCTGCCGTTTCCATGAGGG + Intergenic
1002998122 6:2305792-2305814 AACCTCTGCCCTTTTCATGATGG - Intergenic
1003016321 6:2470269-2470291 AAACTCTCCCCTTTCTCTGATGG - Intergenic
1003695749 6:8405131-8405153 AACCTGTGCCCTTTCCATGATGG + Intergenic
1003758762 6:9151117-9151139 AACCTCTGCCCTTTCTGTGATGG - Intergenic
1003791379 6:9551080-9551102 AACTTCTGCCCTTTCCATGATGG - Intergenic
1004824142 6:19402202-19402224 AACCTCTGCCCTTTCCTTGATGG + Intergenic
1005069107 6:21848244-21848266 GATCTCTGCCCATTTCATGATGG - Intergenic
1005185324 6:23158097-23158119 AACCTCTGCCCTTTCCATGATGG - Intergenic
1005836539 6:29713759-29713781 AACCTCTGGCCCTTCCAGAATGG - Intergenic
1005850528 6:29817416-29817438 AACCTCTGGCCCTTCCAGGATGG - Intergenic
1005857377 6:29872828-29872850 AACCTCTGGCCCTTCCAGGATGG - Intergenic
1005863132 6:29916663-29916685 AACCTCTGGTCCTTCCAGGATGG - Intergenic
1005867769 6:29949085-29949107 AACTTCTGCCCCTTCCAGGATGG - Intergenic
1006062492 6:31434234-31434256 AACTTCTGCCCTTTCCATAATGG - Intergenic
1006066274 6:31464581-31464603 AACCTCTGGCCCTTCCAGGATGG + Intergenic
1007056254 6:38888133-38888155 AAAGTCTGCCCTTTCCCGGATGG - Intronic
1007646218 6:43383339-43383361 AATTACTGCCCTGTCCATGAAGG + Intergenic
1008079237 6:47177537-47177559 AATTGCTGCCCTTTCCATGATGG + Intergenic
1008340408 6:50357311-50357333 AACCGCTGCCCTTTTCATGATGG - Intergenic
1008400431 6:51056498-51056520 AAACTCTGCCCTTTCCATGTTGG - Intergenic
1008820542 6:55626174-55626196 AACCACTGCCCTTTCCATGATGG - Intergenic
1008996391 6:57664873-57664895 AACCTCTGCCCTTTCCATGATGG - Intergenic
1009184907 6:60563666-60563688 AACCTCTGCCCTTTCCATGATGG - Intergenic
1009389962 6:63134042-63134064 AACCTTTGCCCTTTCCATGATGG + Intergenic
1009435330 6:63611006-63611028 AACCTCTGCCCTAGAAATGATGG + Intergenic
1009806637 6:68607976-68607998 AACCTCTGCCCTTTCCATGATGG - Intergenic
1009942367 6:70304146-70304168 AACCTCTGGCCTTGTCTTGAGGG + Intergenic
1010107798 6:72189539-72189561 AACCACTGCCCTTTCCATGATGG + Intronic
1010323718 6:74541522-74541544 AACCACTGCCCATTCCATGATGG - Intergenic
1010818778 6:80389441-80389463 AACCTCTGCCCTTTCCATTACGG - Intergenic
1010938098 6:81885391-81885413 GACTGCTGCCCTTTCCATAATGG + Intergenic
1011039204 6:83012268-83012290 AACCTCTGCCCTTTCCATGATGG + Intronic
1011069257 6:83362686-83362708 AACCTCTGTCCTTTACATGATGG - Intronic
1011136511 6:84106369-84106391 AAATGCTGCCCCTTCCATGATGG + Intergenic
1012511142 6:100003160-100003182 AAACACTGCCCCTTCCATGATGG + Intergenic
1012525817 6:100176702-100176724 ACTCTCTGCCCTGGCCATGATGG - Intergenic
1012820919 6:104083798-104083820 AATCTCTGCCCTTTCCCTGATGG - Intergenic
1012920638 6:105218516-105218538 AACCTCTGCCCTTTTCATGATGG + Intergenic
1012964262 6:105656373-105656395 AAATGCTGCCCTTTCCATGATGG - Intergenic
1013098398 6:106966951-106966973 AAATGCTGCCCCTTCCATGATGG - Intergenic
1014363253 6:120507316-120507338 AACCTCTGCCATTTCCATGATGG + Intergenic
1014417145 6:121196438-121196460 AACCTCTGCCCTTTCCATAATGG - Intronic
1014455872 6:121634554-121634576 AACCTCTGCCTGTTCCATGTTGG - Intergenic
1014534039 6:122595572-122595594 AACCTCTGCCCTTTCCATGATGG + Intronic
1014631790 6:123797825-123797847 AACCTCTGCCCTTCTCATGATGG - Intergenic
1015443136 6:133271530-133271552 AACCTCTTCCCTTTCTATGATGG + Intronic
1015475902 6:133658514-133658536 AATCTCTGCCCTTTCCATGATGG - Intergenic
1015562753 6:134534214-134534236 AAACACTGCCACTTCCATGAGGG - Intergenic
1016119792 6:140331661-140331683 AACTACTACTCTTTCCATGATGG + Intergenic
1016147177 6:140691682-140691704 AGCCTCTGCCCTATCCATTATGG + Intergenic
1016223383 6:141704166-141704188 AACCTCTGCCTTTTCAATGGAGG + Intergenic
1016419468 6:143869637-143869659 AACCTCTGCCTTTTCCATGATGG + Intronic
1016576117 6:145571557-145571579 AACCTCTACCCTTTCCATTATGG + Intronic
1017452464 6:154566573-154566595 AAACTCTCCCCCTTCCATGATGG - Intergenic
1017722543 6:157253884-157253906 AAGCCCTGCCCTTTCCAGGCAGG - Intergenic
1017947823 6:159109940-159109962 AACCTTTGCCCTTTCTAAGCAGG + Intergenic
1017976885 6:159366115-159366137 AACCTCTGCCCTTTCCATGATGG + Intergenic
1018534885 6:164809475-164809497 AACTGCTGCCCTTTCCATGGTGG + Intergenic
1018600035 6:165528532-165528554 AACCTCTGCCCTTTCCATGATGG - Intronic
1018780967 6:167065022-167065044 AAGTGCTGTCCTTTCCATGATGG + Intergenic
1018854119 6:167663227-167663249 AGCCTCTGTCCTTTGCCTGAGGG + Intergenic
1018954909 6:168402987-168403009 AAATACTGCCCCTTCCATGATGG + Intergenic
1019616821 7:1967087-1967109 AACCTGTGGCATTTCCATGTAGG + Intronic
1021965597 7:25915211-25915233 AAGCTCTGGCCCTTCCATAAAGG + Intergenic
1021988966 7:26123953-26123975 AACCTCTGCCCTTTCCATGATGG - Intergenic
1022079037 7:27001362-27001384 AACTTCTGCCATTTCCATGGTGG - Intergenic
1024040693 7:45551178-45551200 AACCTCTGCCCTTTCCATGATGG - Intergenic
1024866242 7:53907375-53907397 AAATGCTGCCCATTCCATGATGG - Intergenic
1024884204 7:54123614-54123636 AACCTCTACCCTTTCCATTATGG + Intergenic
1024891102 7:54204497-54204519 ATCCTCTTGCCTTTCAATGAGGG - Intergenic
1026046343 7:66908081-66908103 AACCTCTGCCCTTTCCATGATGG + Intergenic
1027406907 7:77871974-77871996 AACCTCTGCCCTTTCCGTGATGG + Intronic
1027685945 7:81278986-81279008 AACCACTGCCTTTTCCGTGATGG - Intergenic
1028069767 7:86436792-86436814 ATTCACTGTCCTTTCCATGATGG - Intergenic
1028141881 7:87283021-87283043 AACCTCTGCCCTTTCCATGATGG - Intergenic
1028237975 7:88383851-88383873 AGTCTCTGCCCTTTCCATAATGG - Intergenic
1028935163 7:96456096-96456118 AACCTCTGCTTTTTTCATGATGG - Intergenic
1030368911 7:108675071-108675093 AACCTCTGCCCTTTCCATGATGG - Intergenic
1030883133 7:114905516-114905538 AACTTCTGCCCTTTCCATGTTGG + Intergenic
1030931139 7:115524651-115524673 AATCTCTGCCCTTTCCATGATGG + Intergenic
1031474307 7:122204328-122204350 AACCTCTGCCCTTTCCATGAGGG + Intergenic
1031676691 7:124619317-124619339 ACTCTCTGCCCTTTCCATGATGG - Intergenic
1031833154 7:126651047-126651069 AACCTCTGCCCTTTCCGTGATGG - Intronic
1032142122 7:129341378-129341400 AACCACTTCCCTTACCAGGAAGG - Intronic
1032923336 7:136575097-136575119 CGTCTTTGCCCTTTCCATGATGG + Intergenic
1033076415 7:138254078-138254100 AACCTCTGCCCTTTCCATGATGG - Intergenic
1033248543 7:139739051-139739073 GACCTCTAGCCTGTCCATGAAGG + Intronic
1034100861 7:148449243-148449265 AACCTATGCCCTTCCCATGAAGG - Intergenic
1034169957 7:149055294-149055316 AACCTCTACTGTTTTCATGATGG - Intergenic
1035007379 7:155676485-155676507 AAACTCTGGCTATTCCATGAAGG + Intronic
1035327209 7:158072961-158072983 ACCCTCTGCCCTGCCCAAGATGG + Intronic
1036270863 8:7301579-7301601 AGCCTCTGTGCTGTCCATGATGG + Intergenic
1036350487 8:8008765-8008787 AGCCTCTGTGCTGTCCATGATGG - Intergenic
1036394579 8:8358301-8358323 AACCTCTGGGGTTTCCTTGAGGG - Intronic
1037364438 8:18107231-18107253 AACCTCTGCCCTTTCCATGGTGG + Intergenic
1037898823 8:22675755-22675777 AACCTCATCCCTTTCTTTGAGGG - Intergenic
1038454301 8:27662607-27662629 AAATATTGCCCTTTCCATGATGG + Intronic
1038770161 8:30470898-30470920 AATCTCTTCGCTTTCCATTATGG + Intronic
1038893693 8:31756503-31756525 TAGCTCTCCGCTTTCCATGATGG - Intronic
1038998647 8:32954503-32954525 AAGCCCTGCCCCTTCAATGAGGG - Intergenic
1039292192 8:36108903-36108925 AAACTCTGCTCCTTCCATTATGG + Intergenic
1039324026 8:36465514-36465536 AACCTCTGCTCTTTCCATGATGG + Intergenic
1040004837 8:42611143-42611165 AAAGTCTGCAGTTTCCATGAGGG - Intergenic
1040666042 8:49634407-49634429 AACCTCTGGCTTTTTCCTGATGG + Intergenic
1040912090 8:52529446-52529468 AACCTCTGCCCTTTCCATGATGG - Intergenic
1041448070 8:57975500-57975522 AACCATTGCCCCTTGCATGATGG + Intergenic
1041935450 8:63327034-63327056 AACCTCCACTCTTTCCATGATGG - Intergenic
1042000910 8:64122963-64122985 AACCTCTGCCCTTTCCATGATGG + Intergenic
1042235785 8:66612707-66612729 AACCTCTGCCCTCGCCAGGGAGG + Intronic
1044150944 8:88774101-88774123 AACCTCTGCCCTTTCTATGATGG - Intergenic
1044202537 8:89453519-89453541 AACCTTTTCCCTTTCCATGATGG - Intergenic
1044285827 8:90411414-90411436 AACCTCTGCCTTTTCCATGATGG + Intergenic
1044487007 8:92766152-92766174 AACCTCTGTCCTTTCCATGATGG + Intergenic
1044895917 8:96891287-96891309 AACTGCTGCCCTTTCCATGATGG + Intronic
1045354309 8:101371832-101371854 AACCTCAGCGCTCTCCTTGAGGG - Intergenic
1046128523 8:109940565-109940587 AACCTCTGCTCTTTCCGTGATGG + Intergenic
1046197699 8:110885232-110885254 AACTTCTGCCCTTTCCCTGATGG - Intergenic
1046417506 8:113936773-113936795 AACCTCTGATCTTTCCATGGTGG + Intergenic
1046585637 8:116146707-116146729 AACCTCTGCCCTTTCCATGATGG + Intergenic
1047518273 8:125574300-125574322 CACCTCTGAGCTTACCATGAAGG - Intergenic
1048220432 8:132536192-132536214 AACCTCTGCCTTTTTCCTGCTGG - Intergenic
1049370015 8:142259918-142259940 AACCACTGCCCTGTTCCTGAGGG - Intronic
1049527694 8:143136663-143136685 AGCCTCAGTCCTTACCATGAGGG + Intergenic
1050482930 9:6104435-6104457 AACCTCTGCCCTTTCCATGATGG - Intergenic
1050888617 9:10795713-10795735 AACTGCTACCCATTCCATGAGGG + Intergenic
1052368801 9:27641868-27641890 AACCTCTGCCCTTTCCATGATGG - Intergenic
1052442118 9:28511264-28511286 AACCTCTGCACTTTCCATGATGG + Intronic
1052561424 9:30088968-30088990 AACCACTGCCCTTTTCCTGATGG + Intergenic
1053662961 9:40297403-40297425 AACACCAGCCCTGTCCATGACGG + Intronic
1053695815 9:40638470-40638492 AACCTCTCTCCTTTCCATGGTGG + Intergenic
1053913468 9:42927936-42927958 AACACCAGCCCTGTCCATGATGG + Intergenic
1053942803 9:43269507-43269529 AACCTCTCTCCTTTCCATGGTGG + Intergenic
1054307062 9:63437688-63437710 AACCTCTCTCCTTTCCATGGTGG + Intergenic
1054375088 9:64443627-64443649 AACACCAGCCCTGTCCATGACGG + Intergenic
1054405793 9:64761676-64761698 AACCTCTCTCCTTTCCATGGTGG + Intergenic
1054439420 9:65247163-65247185 AACCTCTCTCCTTTCCATGGTGG + Intergenic
1054490987 9:65774776-65774798 AACCTCTCTCCTTTCCATGGTGG - Intergenic
1054521654 9:66078881-66078903 AACACCAGCCCTGTCCATGACGG - Intergenic
1055844959 9:80550664-80550686 AATCATTACCCTTTCCATGATGG - Intergenic
1056156824 9:83846225-83846247 AACCTCTGCCCTTTCTGTCATGG - Intronic
1056314083 9:85371914-85371936 AACCTCTGCCCTTTCCATGATGG + Intergenic
1056353711 9:85777301-85777323 AACCTCTGCCCTTTCTGTGATGG + Intergenic
1056490164 9:87098398-87098420 AGCCACTGCCCTTGCCATCAGGG + Intergenic
1056525944 9:87443196-87443218 AAACATTGCCCTTTCCATGATGG + Intergenic
1057059132 9:91987571-91987593 AAACTCTGTCCCTTCCATGATGG - Intergenic
1057100443 9:92354231-92354253 AACCTCTGCCCTTTCCATTATGG + Intronic
1058124722 9:101178390-101178412 AACCTCTGCTCTTTCCATGATGG - Intronic
1058259117 9:102808657-102808679 AACTTCTGCCCTTTCCATGATGG + Intergenic
1059196355 9:112374836-112374858 AACCTCTGCCTTTTCCATGATGG + Intergenic
1062135625 9:134926039-134926061 AATGGTTGCCCTTTCCATGATGG - Intergenic
1062444980 9:136589843-136589865 GACCTCTGCCATCTCCATCAAGG + Intergenic
1202778260 9_KI270717v1_random:12082-12104 AACCTCTCTCCTTTCCATGGTGG + Intergenic
1186275225 X:7930926-7930948 GAGCACTGCCCTTTCCATGGGGG + Intergenic
1186279657 X:7978148-7978170 AACTTCTGCCCTTTCCATGATGG - Intergenic
1186469613 X:9811105-9811127 ACCCTCTGCCCTTGCCATGATGG + Intronic
1187524064 X:20038156-20038178 AACTGCTGCCCTTTTCATGATGG - Intronic
1187856247 X:23638197-23638219 AAACTCTGCCATTTGCTTGAAGG - Intergenic
1187934863 X:24326228-24326250 CACCTCTGCCATTTCCATAAGGG + Intergenic
1189868977 X:45362127-45362149 AACCTTGGCCCTACCCATGATGG - Intergenic
1190704820 X:53018728-53018750 AGCCCCTGCCCCTTCCCTGAGGG - Intergenic
1190725370 X:53186929-53186951 TATCTCTGCCCATTCCAAGAGGG - Intergenic
1190996608 X:55616457-55616479 AATCTCTGCCGTTTCCATGATGG + Intergenic
1191095573 X:56670159-56670181 GACCACTGCTCTTTCCATGATGG + Intergenic
1191133902 X:57043489-57043511 AACTGCTGCCCTTTTCATGATGG + Intergenic
1191629882 X:63311555-63311577 AACCTCTGCCCTTTCCACAATGG + Intergenic
1191658650 X:63628778-63628800 AACCTCTGCCTTTTCCATGATGG + Intergenic
1191719097 X:64214682-64214704 AACCACTGCCCTTTCCATGATGG + Intergenic
1191933057 X:66395174-66395196 AAACTCTGCCCTTTCCATTATGG - Intergenic
1191941117 X:66482848-66482870 AACCTCTGCTCTTTCCATGATGG + Intergenic
1191946497 X:66540050-66540072 AACCTCTGCCCTTTCCATGATGG - Intergenic
1192297566 X:69866998-69867020 AACCTCTGCCCTTTCCATAATGG + Intronic
1192531564 X:71892138-71892160 AAACACTGCCCCTTCCATAATGG + Intergenic
1192661428 X:73046756-73046778 AACCGCTGCCCTTTCCATGATGG + Intergenic
1192673111 X:73167379-73167401 AGCCTCTGCCCTTTCCATGATGG + Intergenic
1192996322 X:76516606-76516628 AACTGCTGCCCTTTTCATAATGG - Intergenic
1193053637 X:77126797-77126819 AACCTCTGCTCTTTCCATAATGG - Intergenic
1193356395 X:80524170-80524192 AACCGCTGCCCTTTCCATGATGG - Intergenic
1193447305 X:81619792-81619814 AACCTCTGCCCTTTCCATGATGG - Intergenic
1193573566 X:83174152-83174174 TACCTCTGCCTTTTTCATGATGG + Intergenic
1193833096 X:86311136-86311158 AACCTTTGTTCTTTCCATGATGG - Intronic
1193904621 X:87226848-87226870 AGCCTCTGCACTTTCCATGATGG - Intergenic
1193914672 X:87350916-87350938 AACTGCTGCCCTTTCCATGATGG + Intergenic
1193957437 X:87879247-87879269 AACCTCTGCCATTTCCGTGATGG - Intergenic
1194179460 X:90694908-90694930 CCTCTCTGCCCTTTCCATAATGG + Intergenic
1194210423 X:91063380-91063402 AACCTCTGCCCTTTCCATGATGG - Intergenic
1194232999 X:91347314-91347336 AACCACTACCCTTTCCATGATGG - Intergenic
1194453964 X:94079812-94079834 ACCCACTCCCCTTTCCATGAAGG + Intergenic
1194457096 X:94118515-94118537 AACCTCTGCCCTTTCCATAATGG - Intergenic
1194485250 X:94478341-94478363 AACCTCTGCCCTTTCCATGATGG - Intergenic
1194513282 X:94821233-94821255 AACCTCTGCTCTTTCCATGATGG + Intergenic
1194584260 X:95714089-95714111 AACCTCTGCCCTTTCCATGATGG - Intergenic
1194626725 X:96234033-96234055 AAATGCTGCCCCTTCCATGATGG - Intergenic
1194834095 X:98659825-98659847 AACCTCTGCCCTTTCCATGATGG - Intergenic
1194849102 X:98851137-98851159 AATCTCTGCCCTTTCCATGATGG + Intergenic
1194895597 X:99435679-99435701 AAATAATGCCCTTTCCATGATGG + Intergenic
1195687661 X:107601005-107601027 AACCTCTGGCCTCCCCATGCTGG - Exonic
1195748780 X:108144332-108144354 AATCTCTGCCCTTTCCGTGATGG + Intronic
1195809644 X:108815819-108815841 AATGTCTACCCATTCCATGATGG + Intergenic
1197002436 X:121453945-121453967 AACCTCTGCTCTTTCCATGATGG - Intergenic
1197044565 X:121979338-121979360 AACCCCTGCCCTTTCCATGATGG - Intergenic
1197097554 X:122613442-122613464 AACCTCTGCCCTTTCCATAATGG - Intergenic
1197182247 X:123548810-123548832 AACCTCTGCCCTTTCCATGATGG - Intergenic
1197244899 X:124157972-124157994 ACCCTCTGTACTTGCCATGATGG + Intronic
1197371906 X:125636838-125636860 AACCACTGCCCTTTCCATGATGG + Intergenic
1197500955 X:127242182-127242204 AAACACTGCCACTTCCATGATGG - Intergenic
1197522095 X:127511319-127511341 AAACATTGCCCTTTCCATGATGG - Intergenic
1197537413 X:127707511-127707533 AAACTCTGCACTTTCCATGATGG - Intergenic
1197592023 X:128420415-128420437 AACGTCTGCCCTTTCCATGATGG - Intergenic
1197919014 X:131569622-131569644 AACCTCATCCCCTTGCATGAGGG + Intergenic
1198737693 X:139805642-139805664 AGCCTCTTCCCTTTACCTGAAGG - Intronic
1198782894 X:140256781-140256803 AACTTCTGCCCTTTCTGTGATGG + Intergenic
1198934182 X:141888886-141888908 AACTGCTGCCCTTTCCATGATGG - Intronic
1199024527 X:142920752-142920774 AACCTCTGCCCTTTCCATGACGG - Intergenic
1199144312 X:144347947-144347969 AACCTCTGCCCTTTCCATGATGG + Intergenic
1199310282 X:146313372-146313394 AACCTCTGCCCTTTCTATGATGG + Intergenic
1199616923 X:149663539-149663561 AATCTCTGCTCCTTCCAGGATGG + Intergenic
1199625718 X:149739709-149739731 AATCTCTGCTCCTTCCAGGATGG - Intergenic
1200340330 X:155389612-155389634 AACCTCTGCCCCTTCCATGATGG + Intergenic
1200440390 Y:3205985-3206007 AAACACTACCCTTTCCATAATGG + Intergenic
1200521415 Y:4213047-4213069 AACCTCTGCCCTTTCTATTATGG - Intergenic
1200526124 Y:4277081-4277103 CCTCTCTGCCCTTTCCATAATGG + Intergenic
1200745912 Y:6903838-6903860 AATCTCTGCTCTTTTCATGACGG + Intergenic
1200972995 Y:9176686-9176708 AACCTTTGCCCTTTCCATGATGG + Intergenic
1200976746 Y:9219466-9219488 AACCTCTTCCCTTTCCATAATGG - Intergenic
1201193573 Y:11470386-11470408 AACCTCTCTCCTTTCCATGGTGG + Intergenic
1201529523 Y:14976876-14976898 AACTTCTGCCCTTTCTATGATGG + Intergenic
1201942995 Y:19479574-19479596 AACTTATGCCCTCTCCATCACGG + Intergenic
1202134429 Y:21647077-21647099 AACCTCTTTCCTTTTCATAATGG + Intergenic
1202138083 Y:21687823-21687845 AACCTTTGCCCTTTCCATGATGG - Intergenic