ID: 939069241

View in Genome Browser
Species Human (GRCh38)
Location 2:137518949-137518971
Sequence CTGGAAAAGGGGAAAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939069230_939069241 14 Left 939069230 2:137518912-137518934 CCTCTTCCATCATGGAAAGGGCA 0: 131
1: 184
2: 150
3: 123
4: 297
Right 939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG No data
939069232_939069241 8 Left 939069232 2:137518918-137518940 CCATCATGGAAAGGGCAGAGGTT 0: 121
1: 172
2: 117
3: 132
4: 278
Right 939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939069241 Original CRISPR CTGGAAAAGGGGAAAGGGGC TGG Intronic
No off target data available for this crispr