ID: 939069241 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:137518949-137518971 |
Sequence | CTGGAAAAGGGGAAAGGGGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
939069230_939069241 | 14 | Left | 939069230 | 2:137518912-137518934 | CCTCTTCCATCATGGAAAGGGCA | 0: 131 1: 184 2: 150 3: 123 4: 297 |
||
Right | 939069241 | 2:137518949-137518971 | CTGGAAAAGGGGAAAGGGGCTGG | No data | ||||
939069232_939069241 | 8 | Left | 939069232 | 2:137518918-137518940 | CCATCATGGAAAGGGCAGAGGTT | 0: 121 1: 172 2: 117 3: 132 4: 278 |
||
Right | 939069241 | 2:137518949-137518971 | CTGGAAAAGGGGAAAGGGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
939069241 | Original CRISPR | CTGGAAAAGGGGAAAGGGGC TGG | Intronic | ||
No off target data available for this crispr |