ID: 939072568

View in Genome Browser
Species Human (GRCh38)
Location 2:137560788-137560810
Sequence GACACATGGTGGGCTGCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939072568_939072579 19 Left 939072568 2:137560788-137560810 CCCCTAGCAGCCCACCATGTGTC No data
Right 939072579 2:137560830-137560852 AGCCCCAAACATGTGTACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939072568 Original CRISPR GACACATGGTGGGCTGCTAG GGG (reversed) Intronic
No off target data available for this crispr