ID: 939073624

View in Genome Browser
Species Human (GRCh38)
Location 2:137573090-137573112
Sequence ACTTTAAAAGAAAAAAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939073624_939073626 2 Left 939073624 2:137573090-137573112 CCTTTATTTTTTTCTTTTAAAGT No data
Right 939073626 2:137573115-137573137 TAAAAAATTGGAAGCACAACAGG No data
939073624_939073628 30 Left 939073624 2:137573090-137573112 CCTTTATTTTTTTCTTTTAAAGT No data
Right 939073628 2:137573143-137573165 GGCAAAATAAATATTATTCAAGG No data
939073624_939073627 9 Left 939073624 2:137573090-137573112 CCTTTATTTTTTTCTTTTAAAGT No data
Right 939073627 2:137573122-137573144 TTGGAAGCACAACAGGAGTATGG No data
939073624_939073625 -10 Left 939073624 2:137573090-137573112 CCTTTATTTTTTTCTTTTAAAGT No data
Right 939073625 2:137573103-137573125 CTTTTAAAGTCTTAAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939073624 Original CRISPR ACTTTAAAAGAAAAAAATAA AGG (reversed) Intronic
No off target data available for this crispr