ID: 939073627

View in Genome Browser
Species Human (GRCh38)
Location 2:137573122-137573144
Sequence TTGGAAGCACAACAGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939073624_939073627 9 Left 939073624 2:137573090-137573112 CCTTTATTTTTTTCTTTTAAAGT No data
Right 939073627 2:137573122-137573144 TTGGAAGCACAACAGGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939073627 Original CRISPR TTGGAAGCACAACAGGAGTA TGG Intronic
No off target data available for this crispr