ID: 939080410

View in Genome Browser
Species Human (GRCh38)
Location 2:137654297-137654319
Sequence GTTCAGCAGTACCACGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939080410_939080413 5 Left 939080410 2:137654297-137654319 CCTACAGCGTGGTACTGCTGAAC No data
Right 939080413 2:137654325-137654347 CTTTGACTTGGTATCTCCTTTGG No data
939080410_939080411 -7 Left 939080410 2:137654297-137654319 CCTACAGCGTGGTACTGCTGAAC No data
Right 939080411 2:137654313-137654335 GCTGAACAGCCACTTTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939080410 Original CRISPR GTTCAGCAGTACCACGCTGT AGG (reversed) Intronic