ID: 939080413

View in Genome Browser
Species Human (GRCh38)
Location 2:137654325-137654347
Sequence CTTTGACTTGGTATCTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939080409_939080413 8 Left 939080409 2:137654294-137654316 CCTCCTACAGCGTGGTACTGCTG No data
Right 939080413 2:137654325-137654347 CTTTGACTTGGTATCTCCTTTGG No data
939080408_939080413 12 Left 939080408 2:137654290-137654312 CCAACCTCCTACAGCGTGGTACT No data
Right 939080413 2:137654325-137654347 CTTTGACTTGGTATCTCCTTTGG No data
939080406_939080413 30 Left 939080406 2:137654272-137654294 CCTAGGGGATCTGTGAAACCAAC No data
Right 939080413 2:137654325-137654347 CTTTGACTTGGTATCTCCTTTGG No data
939080410_939080413 5 Left 939080410 2:137654297-137654319 CCTACAGCGTGGTACTGCTGAAC No data
Right 939080413 2:137654325-137654347 CTTTGACTTGGTATCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939080413 Original CRISPR CTTTGACTTGGTATCTCCTT TGG Intronic
No off target data available for this crispr