ID: 939081362

View in Genome Browser
Species Human (GRCh38)
Location 2:137665299-137665321
Sequence TTTTATCCATGGATGGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939081356_939081362 -3 Left 939081356 2:137665279-137665301 CCACAAGTAAGCCCTTAACCTTT No data
Right 939081362 2:137665299-137665321 TTTTATCCATGGATGGAATTTGG No data
939081355_939081362 19 Left 939081355 2:137665257-137665279 CCAGGGAAATGAGTCTTCAAATC No data
Right 939081362 2:137665299-137665321 TTTTATCCATGGATGGAATTTGG No data
939081354_939081362 20 Left 939081354 2:137665256-137665278 CCCAGGGAAATGAGTCTTCAAAT No data
Right 939081362 2:137665299-137665321 TTTTATCCATGGATGGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939081362 Original CRISPR TTTTATCCATGGATGGAATT TGG Intronic
No off target data available for this crispr