ID: 939083806

View in Genome Browser
Species Human (GRCh38)
Location 2:137693293-137693315
Sequence GAGTGGGTCTAGAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939083806_939083812 17 Left 939083806 2:137693293-137693315 CCTTTTTCCCTCTAGACCCACTC No data
Right 939083812 2:137693333-137693355 ACTCTTGAAGACAAAATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939083806 Original CRISPR GAGTGGGTCTAGAGGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr