ID: 939096041

View in Genome Browser
Species Human (GRCh38)
Location 2:137834569-137834591
Sequence CTGCCGTCCAGGTGCAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939096041_939096045 -9 Left 939096041 2:137834569-137834591 CCCATGCTGCACCTGGACGGCAG No data
Right 939096045 2:137834583-137834605 GGACGGCAGGTTTCCACGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939096041 Original CRISPR CTGCCGTCCAGGTGCAGCAT GGG (reversed) Intergenic