ID: 939098550

View in Genome Browser
Species Human (GRCh38)
Location 2:137866169-137866191
Sequence GTATGAGCTAAATCCATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939098550_939098551 -9 Left 939098550 2:137866169-137866191 CCAGTTATGGATTTAGCTCATAC No data
Right 939098551 2:137866183-137866205 AGCTCATACAGACAAACCACTGG No data
939098550_939098555 15 Left 939098550 2:137866169-137866191 CCAGTTATGGATTTAGCTCATAC No data
Right 939098555 2:137866207-137866229 CCTCATTCTGACTAAATACATGG No data
939098550_939098552 -8 Left 939098550 2:137866169-137866191 CCAGTTATGGATTTAGCTCATAC No data
Right 939098552 2:137866184-137866206 GCTCATACAGACAAACCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939098550 Original CRISPR GTATGAGCTAAATCCATAAC TGG (reversed) Intergenic
No off target data available for this crispr