ID: 939103607

View in Genome Browser
Species Human (GRCh38)
Location 2:137924548-137924570
Sequence GTCCAGGAATAGGGAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939103607_939103612 14 Left 939103607 2:137924548-137924570 CCTCTTTCTCCCTATTCCTGGAC No data
Right 939103612 2:137924585-137924607 TTTGCATTGTCTTTGCTGAAGGG No data
939103607_939103611 13 Left 939103607 2:137924548-137924570 CCTCTTTCTCCCTATTCCTGGAC No data
Right 939103611 2:137924584-137924606 TTTTGCATTGTCTTTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939103607 Original CRISPR GTCCAGGAATAGGGAGAAAG AGG (reversed) Intergenic
No off target data available for this crispr