ID: 939103608

View in Genome Browser
Species Human (GRCh38)
Location 2:137924557-137924579
Sequence CACAGAAGAGTCCAGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939103608_939103612 5 Left 939103608 2:137924557-137924579 CCCTATTCCTGGACTCTTCTGTG No data
Right 939103612 2:137924585-137924607 TTTGCATTGTCTTTGCTGAAGGG No data
939103608_939103613 27 Left 939103608 2:137924557-137924579 CCCTATTCCTGGACTCTTCTGTG No data
Right 939103613 2:137924607-137924629 GCAAGTTCTTTCTATATAGTTGG No data
939103608_939103611 4 Left 939103608 2:137924557-137924579 CCCTATTCCTGGACTCTTCTGTG No data
Right 939103611 2:137924584-137924606 TTTTGCATTGTCTTTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939103608 Original CRISPR CACAGAAGAGTCCAGGAATA GGG (reversed) Intergenic
No off target data available for this crispr