ID: 939103610

View in Genome Browser
Species Human (GRCh38)
Location 2:137924564-137924586
Sequence AAAAGAGCACAGAAGAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939103610_939103614 25 Left 939103610 2:137924564-137924586 CCTGGACTCTTCTGTGCTCTTTT No data
Right 939103614 2:137924612-137924634 TTCTTTCTATATAGTTGGAAAGG No data
939103610_939103613 20 Left 939103610 2:137924564-137924586 CCTGGACTCTTCTGTGCTCTTTT No data
Right 939103613 2:137924607-137924629 GCAAGTTCTTTCTATATAGTTGG No data
939103610_939103611 -3 Left 939103610 2:137924564-137924586 CCTGGACTCTTCTGTGCTCTTTT No data
Right 939103611 2:137924584-137924606 TTTTGCATTGTCTTTGCTGAAGG No data
939103610_939103612 -2 Left 939103610 2:137924564-137924586 CCTGGACTCTTCTGTGCTCTTTT No data
Right 939103612 2:137924585-137924607 TTTGCATTGTCTTTGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939103610 Original CRISPR AAAAGAGCACAGAAGAGTCC AGG (reversed) Intergenic
No off target data available for this crispr