ID: 939103611

View in Genome Browser
Species Human (GRCh38)
Location 2:137924584-137924606
Sequence TTTTGCATTGTCTTTGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939103608_939103611 4 Left 939103608 2:137924557-137924579 CCCTATTCCTGGACTCTTCTGTG No data
Right 939103611 2:137924584-137924606 TTTTGCATTGTCTTTGCTGAAGG No data
939103607_939103611 13 Left 939103607 2:137924548-137924570 CCTCTTTCTCCCTATTCCTGGAC No data
Right 939103611 2:137924584-137924606 TTTTGCATTGTCTTTGCTGAAGG No data
939103610_939103611 -3 Left 939103610 2:137924564-137924586 CCTGGACTCTTCTGTGCTCTTTT No data
Right 939103611 2:137924584-137924606 TTTTGCATTGTCTTTGCTGAAGG No data
939103609_939103611 3 Left 939103609 2:137924558-137924580 CCTATTCCTGGACTCTTCTGTGC No data
Right 939103611 2:137924584-137924606 TTTTGCATTGTCTTTGCTGAAGG No data
939103604_939103611 24 Left 939103604 2:137924537-137924559 CCATGGGCCTGCCTCTTTCTCCC No data
Right 939103611 2:137924584-137924606 TTTTGCATTGTCTTTGCTGAAGG No data
939103605_939103611 17 Left 939103605 2:137924544-137924566 CCTGCCTCTTTCTCCCTATTCCT No data
Right 939103611 2:137924584-137924606 TTTTGCATTGTCTTTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939103611 Original CRISPR TTTTGCATTGTCTTTGCTGA AGG Intergenic
No off target data available for this crispr