ID: 939105714

View in Genome Browser
Species Human (GRCh38)
Location 2:137946213-137946235
Sequence CAGAACATGGACAGGTGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939105707_939105714 -5 Left 939105707 2:137946195-137946217 CCTCTTTTACCTTGTATCCAGAA No data
Right 939105714 2:137946213-137946235 CAGAACATGGACAGGTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939105714 Original CRISPR CAGAACATGGACAGGTGGTT GGG Intergenic
No off target data available for this crispr