ID: 939110913

View in Genome Browser
Species Human (GRCh38)
Location 2:138005967-138005989
Sequence GACATACGGTGTTAAAGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939110913_939110916 23 Left 939110913 2:138005967-138005989 CCCATACTTTAACACCGTATGTC No data
Right 939110916 2:138006013-138006035 ATGAAGAATTGCTTTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939110913 Original CRISPR GACATACGGTGTTAAAGTAT GGG (reversed) Intronic
No off target data available for this crispr