ID: 939113454

View in Genome Browser
Species Human (GRCh38)
Location 2:138034023-138034045
Sequence GAGAAGAAACAGAAAGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939113452_939113454 -2 Left 939113452 2:138034002-138034024 CCTGCATCACTAGGTTATTGGGA No data
Right 939113454 2:138034023-138034045 GAGAAGAAACAGAAAGATGGTGG No data
939113448_939113454 26 Left 939113448 2:138033974-138033996 CCTGGCTGGCAAAGTGACTGAGA No data
Right 939113454 2:138034023-138034045 GAGAAGAAACAGAAAGATGGTGG No data
939113447_939113454 27 Left 939113447 2:138033973-138033995 CCCTGGCTGGCAAAGTGACTGAG No data
Right 939113454 2:138034023-138034045 GAGAAGAAACAGAAAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939113454 Original CRISPR GAGAAGAAACAGAAAGATGG TGG Intergenic
No off target data available for this crispr