ID: 939114160

View in Genome Browser
Species Human (GRCh38)
Location 2:138041353-138041375
Sequence CTGCTGTCAGTGTTCAGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939114160_939114163 8 Left 939114160 2:138041353-138041375 CCTATCCTGAACACTGACAGCAG No data
Right 939114163 2:138041384-138041406 GCAGTATTTTGCAGTCAAGAAGG No data
939114160_939114165 10 Left 939114160 2:138041353-138041375 CCTATCCTGAACACTGACAGCAG No data
Right 939114165 2:138041386-138041408 AGTATTTTGCAGTCAAGAAGGGG No data
939114160_939114164 9 Left 939114160 2:138041353-138041375 CCTATCCTGAACACTGACAGCAG No data
Right 939114164 2:138041385-138041407 CAGTATTTTGCAGTCAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939114160 Original CRISPR CTGCTGTCAGTGTTCAGGAT AGG (reversed) Intergenic
No off target data available for this crispr