ID: 939117560

View in Genome Browser
Species Human (GRCh38)
Location 2:138077716-138077738
Sequence GAGTTTTGGACCTGGAACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939117560_939117566 24 Left 939117560 2:138077716-138077738 CCGCAGTTCCAGGTCCAAAACTC No data
Right 939117566 2:138077763-138077785 CATTATTGTTCTTAAGATTTGGG No data
939117560_939117565 23 Left 939117560 2:138077716-138077738 CCGCAGTTCCAGGTCCAAAACTC No data
Right 939117565 2:138077762-138077784 CCATTATTGTTCTTAAGATTTGG No data
939117560_939117563 0 Left 939117560 2:138077716-138077738 CCGCAGTTCCAGGTCCAAAACTC No data
Right 939117563 2:138077739-138077761 AGTGTCTCACTAAGATTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939117560 Original CRISPR GAGTTTTGGACCTGGAACTG CGG (reversed) Intergenic