ID: 939120090

View in Genome Browser
Species Human (GRCh38)
Location 2:138105869-138105891
Sequence GGGTTGAAGCAAATTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939120090 Original CRISPR GGGTTGAAGCAAATTGAGCA GGG (reversed) Intergenic
902218058 1:14947135-14947157 GGGAGGAAGCAACTTGAGCACGG - Intronic
902288166 1:15419861-15419883 GGGTTGGAGAAAAGTGAGGAAGG - Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
910057130 1:83046321-83046343 AGGTTGAACCAAATTGAGACAGG + Intergenic
910699605 1:90059628-90059650 GGGATGAAGCCACTTGATCATGG + Intergenic
912220352 1:107666866-107666888 GGGTTTAAGTGACTTGAGCAAGG + Intronic
915098259 1:153479396-153479418 TGGTGGAAGCAAAGTGAGAATGG - Intergenic
915989569 1:160500344-160500366 GGGCTGGAGCAAAGTGAACAAGG - Intronic
916239082 1:162621508-162621530 GGGTTGAAGGAAATTGTAGATGG + Intergenic
916924159 1:169499833-169499855 TGGCTGAAGCCAAATGAGCAAGG - Intergenic
917918728 1:179731221-179731243 GGGTTAAAACAAATTGAGACAGG + Intergenic
919270252 1:195332573-195332595 TGGTTGAAGATAATTGAGCTGGG - Intergenic
919675673 1:200380411-200380433 GGGTTGAAGCAAAACTGGCATGG - Intergenic
920507643 1:206527728-206527750 GGGTTGAAGGCATTTGGGCAAGG - Intronic
921867385 1:220099997-220100019 GGGAAGAAGGAAATTGAGCTTGG + Intronic
922988303 1:229883926-229883948 GGGTTGGAGCAAATAGAGTGAGG + Intergenic
924834192 1:247632049-247632071 GGGATGAAGCTACTTGATCATGG + Intergenic
1064934267 10:20662534-20662556 GAAGTGAAGAAAATTGAGCAAGG - Intergenic
1065045055 10:21739535-21739557 TGCTTGAAACACATTGAGCAGGG - Intronic
1066493270 10:35915715-35915737 GGGGTGAAGCAATTTGGGCAAGG - Intergenic
1067234827 10:44438834-44438856 GGGTTGAAGGAAGTTGACTAAGG - Intergenic
1067271649 10:44796756-44796778 TGGCTGAAGCAAAGTGTGCAAGG - Intergenic
1068373382 10:56148269-56148291 GAATTGAAACAAATTGAGAAAGG + Intergenic
1069160202 10:65083755-65083777 GGGCTGTAGCAGAGTGAGCAGGG + Intergenic
1069411552 10:68159144-68159166 GGGTTGAACTAAATTTAGGATGG + Intronic
1069914785 10:71780763-71780785 GGGGTGAAGGAAAAGGAGCAGGG + Intronic
1070792146 10:79195870-79195892 GAGGTGAAGCAAATTGCCCAAGG - Intronic
1071794371 10:88989746-88989768 GGGTTGAATCTAATTGGGAAGGG + Intronic
1072901927 10:99415742-99415764 GGGATGAAGCCCATTGATCATGG - Intronic
1074474455 10:113756856-113756878 CTGTTGAAGCATTTTGAGCATGG + Intronic
1075592127 10:123699480-123699502 GGGATGGAGCAACTTGTGCAAGG + Intergenic
1081065934 11:38538927-38538949 TGGATGAAGAAATTTGAGCAGGG - Intergenic
1088628661 11:111752632-111752654 GGGTTAAAGTAACTTGAGCAAGG - Intronic
1092658488 12:10713469-10713491 GGTTTTAAACAAAGTGAGCAAGG + Intronic
1093101309 12:15032927-15032949 AGGTTTAAGCAAAGTGAGAAGGG - Intergenic
1096442504 12:51656010-51656032 TGGATGAAGCAAATTGAACTAGG + Intronic
1097628629 12:62032292-62032314 GGGTTGAATGAAATTGAGAAAGG - Intronic
1098158938 12:67629295-67629317 TGGCTGAAGCGAAGTGAGCAAGG + Intergenic
1099048800 12:77757991-77758013 TAGTTGAAGCAAAGTAAGCAAGG - Intergenic
1099168303 12:79334623-79334645 GGGTTGCAGGAAATAGAACAAGG - Intronic
1101462561 12:104911779-104911801 GGGTTCAAGCCAATTAAGGATGG + Intronic
1101714855 12:107301804-107301826 TGGATGCAGCAAAGTGAGCAAGG - Intergenic
1104310426 12:127649796-127649818 GTGTTGAAGCAAACTAAACATGG + Intergenic
1104655652 12:130572159-130572181 GGGATGAAGGAAACTTAGCACGG + Intronic
1104952286 12:132446774-132446796 GGATTGCAGCAGTTTGAGCAGGG - Intergenic
1105346252 13:19575249-19575271 GGGTTGAAGAAAATAGAAAAAGG + Intergenic
1105898633 13:24739210-24739232 GAGTTGAAGCAACTTGCCCAAGG + Intergenic
1106063284 13:26317071-26317093 GGGTTGAAGAAAAGTGAACAAGG + Intronic
1108684756 13:52809247-52809269 TGCTTGAAGAAAATGGAGCATGG - Intergenic
1109471216 13:62806828-62806850 AGGCTGAAACAATTTGAGCAAGG + Intergenic
1111049387 13:82859947-82859969 GGGTGGAAGAAAATTGAGTGTGG - Intergenic
1112667013 13:101586353-101586375 TGGTTGAAGTGAATTGAACATGG + Intronic
1113137274 13:107106147-107106169 GGGATGAATCCATTTGAGCATGG + Intergenic
1115519729 14:34221396-34221418 GGGGTGAAGCAAATTATCCAGGG - Intronic
1116103259 14:40467731-40467753 AGGTTTAAGCAAATTGTGGAAGG + Intergenic
1117124392 14:52605883-52605905 GGGATGAATCAATTTGATCATGG + Intronic
1119674223 14:76541815-76541837 GGGCTGAAGCAAAGAGAGGAGGG + Intergenic
1120336473 14:83163195-83163217 GTGTTGAAGCAACTTCAGTATGG - Intergenic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1123459242 15:20453937-20453959 TGGTTGAAGCAGAATGTGCAGGG - Intergenic
1123658818 15:22546481-22546503 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1124265480 15:28229774-28229796 TGGTTGAAGCAGAATGTGCAGGG - Exonic
1124312683 15:28640973-28640995 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1125874185 15:43129680-43129702 GGCTTGAGGCACATTGAGGAAGG - Intronic
1126280198 15:46938521-46938543 GGGTGGAAGGAAGTTGAGTAGGG - Intergenic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1127911304 15:63418291-63418313 GGGTTGAAGCAGCTTCTGCAGGG + Intergenic
1128558947 15:68651839-68651861 GCTTTGAAGGAAATGGAGCAAGG - Intronic
1130385821 15:83411074-83411096 GGGTTTAACCACATTGACCAGGG + Intergenic
1130756309 15:86768059-86768081 GGCTTGAAGCAACATGATCAGGG - Intronic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1131603896 15:93880090-93880112 GAGTTGAAGTAAAAAGAGCATGG - Intergenic
1131759850 15:95610487-95610509 GGGTTGAATCAGATTTAGGAAGG - Intergenic
1134169435 16:11956824-11956846 GGGGTGAAGCCAACTGAGCATGG - Intronic
1138156644 16:54711891-54711913 TAGTTCAAGGAAATTGAGCAGGG - Intergenic
1139144777 16:64310087-64310109 GGGGTGAAGAAAAGTGAGGAGGG + Intergenic
1142626784 17:1197345-1197367 GGTTTGAAAAAAATTGGGCAGGG + Intronic
1147529316 17:41259972-41259994 GGGATGAAGCAATTTGATCATGG - Intergenic
1150874129 17:68949594-68949616 GGGATGAAGCGACTTGATCATGG - Intronic
1156898436 18:42273141-42273163 TGATTGAAGAAAAGTGAGCAGGG + Intergenic
1159639827 18:70850555-70850577 TGGTTGGAGCAAAATGAGCTGGG - Intergenic
1162392371 19:10397349-10397371 GGGTTGAGGCAGGTTGAGCCTGG - Intronic
1164572191 19:29382613-29382635 GGGAGGAAGAAAACTGAGCAGGG - Intergenic
1165168989 19:33877739-33877761 GGGTTGAAGGACACTGTGCAGGG - Intergenic
1166201289 19:41239327-41239349 GGGTTGAAGCAGGTTGGGCATGG - Intronic
1166255595 19:41601972-41601994 GGGTTGAGGCATCTTGGGCAGGG + Intronic
1166289692 19:41854564-41854586 GGGCTGAAGCGAAAGGAGCATGG - Intergenic
1168302173 19:55411396-55411418 AGGATGAAGCAAAGAGAGCATGG - Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
926780416 2:16466055-16466077 GGGTGAAAGCAAGTTGAGAAAGG - Intergenic
928099828 2:28430439-28430461 GAGTTGAAGCAATTTGTCCAAGG + Intergenic
928555134 2:32415861-32415883 GGGTGGAAGCAAAATGAGCGAGG - Exonic
932882726 2:75518804-75518826 GGGATGAGGCAAACTGATCAAGG - Intronic
936893998 2:117406077-117406099 TGGGTGAAGCTAAGTGAGCATGG + Intergenic
937352721 2:121176541-121176563 GAGGTGAAGCAAGTTGTGCAAGG - Intergenic
938156517 2:128945652-128945674 GGGATGAAGCCCATTGATCATGG + Intergenic
939120090 2:138105869-138105891 GGGTTGAAGCAAATTGAGCAGGG - Intergenic
939618078 2:144382931-144382953 GGGTTAAAGCAAGTTGGGCAGGG + Intergenic
941634800 2:167924992-167925014 GGTGTGAAGGAAATTGAGCTGGG - Intergenic
942016748 2:171825270-171825292 AGGTTGAAGTAAATTGAAAATGG - Intronic
942504461 2:176626905-176626927 GGGCTGAAGCAGAAAGAGCAAGG - Intergenic
942786337 2:179706668-179706690 GGGTTGAAACTGACTGAGCAAGG + Intronic
945355549 2:208835369-208835391 GGGATGAAGCCACTTGATCATGG - Intronic
946828539 2:223704314-223704336 GAGTTTAAGCAACTTGATCAAGG + Intergenic
947385771 2:229588562-229588584 GGGATGAAGGAAATTCAGCATGG - Intronic
948077419 2:235176079-235176101 GTGCTGAAACAAATTAAGCAGGG + Intergenic
948438404 2:237968863-237968885 GAGTTGAAGCATATTGAAGAAGG + Exonic
1168957232 20:1842784-1842806 GGGCTGGAGCAAAGTGAGCGAGG - Intergenic
1169326602 20:4681794-4681816 GGGCAGAAGCAAATTGAAGAGGG - Intergenic
1169963631 20:11191018-11191040 GGGTTGAAGTACAGTGAGTAAGG + Intergenic
1172115144 20:32569253-32569275 TGGCTGAAGGAAAGTGAGCAGGG + Intronic
1173303291 20:41823583-41823605 GGATTGAAGGAAATGGAGAAGGG - Intergenic
1173582216 20:44155250-44155272 GTGGTGAAGCAACTTGGGCAAGG + Intronic
1173590899 20:44223958-44223980 AGGTAGAAGCACCTTGAGCATGG - Intergenic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG + Intronic
1178196647 21:30352862-30352884 GGATTGAAGAAGATTGAGCATGG - Intronic
1180016029 21:45084569-45084591 GTCTTGAATTAAATTGAGCAGGG + Intronic
1180595260 22:16968817-16968839 GTGTTTCAGCAATTTGAGCAAGG - Intronic
1185081716 22:48713163-48713185 GGGGTGAAGAAAATTCAGCGGGG + Intronic
949530435 3:4950191-4950213 GGGATGAAGCAAGGTGACCAGGG - Intergenic
950202580 3:11055539-11055561 GGGCTCAAGAGAATTGAGCACGG - Intergenic
950863877 3:16173782-16173804 TGGCTGAAGCAAAGAGAGCAGGG - Intergenic
952291416 3:32020268-32020290 GGGCTAAAGGAAATTGGGCAGGG - Intronic
953093868 3:39755843-39755865 AAGATGAAGCAAATAGAGCAAGG - Intergenic
953440814 3:42915424-42915446 GGGTTACAGCAAATTGTGAATGG - Exonic
956432830 3:69204900-69204922 AGGTTAAAGTAAATTGACCAAGG + Intronic
958192766 3:90204639-90204661 TGGTTAAAGCATAGTGAGCAAGG - Intergenic
959288753 3:104445801-104445823 GGGTTGATTTAAATTGTGCAGGG - Intergenic
959943838 3:112106917-112106939 GGCTTGGTGCAAACTGAGCAAGG - Intronic
960196864 3:114779168-114779190 GTGTTAAAGCAAATAGAACAAGG - Intronic
961212534 3:125136989-125137011 GGGTTGAGGGAAAAGGAGCAGGG - Intronic
962904263 3:139787949-139787971 TGGTTGTAGCAGATTAAGCAAGG - Intergenic
963807664 3:149741587-149741609 TTGTTGAACCAAATGGAGCAGGG + Exonic
964081650 3:152766067-152766089 GGGATGAAGCCGATTGATCATGG - Intergenic
964370998 3:156000393-156000415 GGGATGAAGCCGATTGATCATGG + Intergenic
964747666 3:160027089-160027111 TGGTTAAAGCAAAGTGGGCAAGG + Intronic
967281380 3:187827262-187827284 GGGTAGAAGAAAATAGAGAATGG - Intergenic
967488554 3:190062221-190062243 GGGTTGAAGCAAATAAGGAAGGG - Intronic
972335303 4:38102523-38102545 GGGAAGAAGCAAATAGGGCAAGG + Intronic
974365142 4:60937444-60937466 TGGTAGAAGCAAATTGACGATGG - Intergenic
983915807 4:173289359-173289381 GCGTCCAAGAAAATTGAGCATGG + Intronic
984024340 4:174524565-174524587 GAGTTGAAGCAAATTGCCCAAGG - Intergenic
984307944 4:178018698-178018720 GGGATGAAGCCACTTGATCATGG - Intergenic
986323395 5:6652276-6652298 GGGCTGTAGCAGAATGAGCAGGG + Intronic
988818576 5:34858851-34858873 GGGCTTAAGCAAACTGAACAAGG - Intronic
990269115 5:54115742-54115764 GGGTTGATGCATATCAAGCAGGG + Intronic
990759770 5:59115464-59115486 TGGATGAAGCAAATTAAGAAAGG - Intronic
993576843 5:89612565-89612587 GGGTTGAAGCCCACTGATCATGG + Intergenic
993880961 5:93360314-93360336 GGGTTAAAAAAAATTGAGGAGGG + Intergenic
994279110 5:97878754-97878776 TGGTTTAAGAAAATGGAGCACGG + Intergenic
996485323 5:124026884-124026906 TGATTGAAGCAGAGTGAGCAAGG + Intergenic
999661206 5:153864481-153864503 GGGTTGAGGGGAATGGAGCAAGG - Intergenic
999703287 5:154248152-154248174 GGGATGAAGCCACTTGATCATGG + Intronic
999810607 5:155123728-155123750 GGGATGAAGCCACTTGATCATGG - Intergenic
1001158611 5:169294542-169294564 GGGTTGGAGCAAGTTTAGGATGG + Intronic
1003647829 6:7929484-7929506 GGGATGAAGCAACTTGATCATGG - Intronic
1006666595 6:35699080-35699102 GGGTTGGGGCAACTTGAACAGGG + Intronic
1011785248 6:90836439-90836461 GTGTAGCAGCACATTGAGCACGG + Intergenic
1011968935 6:93197450-93197472 GGTTTTAAGCAATTTGATCATGG - Intergenic
1020530411 7:9326281-9326303 GGGGTGAAGCAATTGGAGTAGGG - Intergenic
1020909608 7:14112047-14112069 TGGTTGAAACAAAGTGAGCAAGG - Intergenic
1020963249 7:14832771-14832793 TAGTGGAAGCAGATTGAGCAAGG - Intronic
1021276186 7:18654515-18654537 GGGCTGAAGTAGATTGAGCAAGG + Intronic
1021635184 7:22684842-22684864 GGGTGGAGGCCAATTGACCATGG + Intergenic
1022641670 7:32191367-32191389 GGGTGGAAGGAAAATGAGTAAGG - Intronic
1023933454 7:44722011-44722033 AGGTTTAAGCAAATTGTGGAAGG - Intergenic
1026544413 7:71309345-71309367 AGGAAGAAGCAAATTTAGCAGGG - Intronic
1031145148 7:117989316-117989338 GGATAGGAGAAAATTGAGCATGG + Intergenic
1034742581 7:153492034-153492056 GAGTTGAAGTAAATTAAGAATGG - Intergenic
1040705245 8:50118204-50118226 GGGTTGAAGCCTGTTGAGAATGG - Intronic
1043139078 8:76564928-76564950 GGGTTGAAGCACAGTGATCCTGG - Intergenic
1043955594 8:86355979-86356001 AGGTTGAAGTAAATTGCCCAGGG - Intronic
1044930356 8:97246265-97246287 GTTTTGATGCAAATTGATCAAGG - Intergenic
1048342628 8:133552517-133552539 GCGTTTGAGCAAACTGAGCAGGG + Intronic
1049652199 8:143775984-143776006 AGGTTGAAAAAAATTGAGGAGGG + Intergenic
1050426827 9:5519764-5519786 GGGGAGAAGCAAATTAAGGAAGG - Intronic
1051220390 9:14842676-14842698 GAGATGGAGCAGATTGAGCAAGG + Intronic
1057953755 9:99390933-99390955 GGGTTGCAGCTGAGTGAGCAAGG + Intergenic
1062069447 9:134547699-134547721 GGGGTGAAGGGAATTGAGAATGG - Intergenic
1186391135 X:9160614-9160636 GAGATGAAGCAAATGAAGCATGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188686882 X:33080314-33080336 GGGTTTAAGCAAAGTGAAAAGGG - Intronic
1189044382 X:37574749-37574771 TGGTTGAAGAAGAATGAGCAAGG - Intronic
1189337376 X:40178172-40178194 GGGTTGAAGCCAGTTGCACAGGG - Intergenic
1189688823 X:43594122-43594144 GGGTTGAAGCCCACTGAGCGAGG + Intergenic
1190992883 X:55570318-55570340 GGGATGAAGCCAATTGATTATGG - Intergenic
1191582807 X:62783609-62783631 GGGATGAAGCCCATTGATCATGG - Intergenic
1195005013 X:100677277-100677299 TGGTTGAAGCATAGTGAGCAAGG + Intronic
1195368387 X:104149187-104149209 GGATTGAAGTAAAAGGAGCAAGG - Intronic
1197280597 X:124531072-124531094 GGGTTGAGGAAGGTTGAGCAAGG + Intronic
1197417901 X:126197723-126197745 GGGTTGATGCAACTTGTTCAAGG - Intergenic
1201887577 Y:18902434-18902456 GGAAGGAAGTAAATTGAGCAGGG + Intergenic