ID: 939125922

View in Genome Browser
Species Human (GRCh38)
Location 2:138177333-138177355
Sequence TGGAGTTAAAAGACCTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939125922_939125926 -2 Left 939125922 2:138177333-138177355 CCAACCCAGGTCTTTTAACTCCA No data
Right 939125926 2:138177354-138177376 CACACCCCACCTGCTTTTCATGG No data
939125922_939125931 8 Left 939125922 2:138177333-138177355 CCAACCCAGGTCTTTTAACTCCA No data
Right 939125931 2:138177364-138177386 CTGCTTTTCATGGCACATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939125922 Original CRISPR TGGAGTTAAAAGACCTGGGT TGG (reversed) Intergenic
No off target data available for this crispr