ID: 939127491

View in Genome Browser
Species Human (GRCh38)
Location 2:138194581-138194603
Sequence TGGATAGAAATTCAGTCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939127487_939127491 15 Left 939127487 2:138194543-138194565 CCTGTATCTAGACCTGTTTATTC No data
Right 939127491 2:138194581-138194603 TGGATAGAAATTCAGTCCATAGG No data
939127489_939127491 3 Left 939127489 2:138194555-138194577 CCTGTTTATTCTTACTCATGGCT No data
Right 939127491 2:138194581-138194603 TGGATAGAAATTCAGTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939127491 Original CRISPR TGGATAGAAATTCAGTCCAT AGG Intergenic
No off target data available for this crispr