ID: 939129513

View in Genome Browser
Species Human (GRCh38)
Location 2:138217529-138217551
Sequence ATATGTGTGTGGAGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939129513_939129521 25 Left 939129513 2:138217529-138217551 CCCACTGCCCTCCACACACATAT No data
Right 939129521 2:138217577-138217599 AGTTAAACTCTGAGGACATTTGG No data
939129513_939129518 -7 Left 939129513 2:138217529-138217551 CCCACTGCCCTCCACACACATAT No data
Right 939129518 2:138217545-138217567 CACATATATCATTACCAGTGAGG No data
939129513_939129520 17 Left 939129513 2:138217529-138217551 CCCACTGCCCTCCACACACATAT No data
Right 939129520 2:138217569-138217591 TAAAGAATAGTTAAACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939129513 Original CRISPR ATATGTGTGTGGAGGGCAGT GGG (reversed) Intergenic
No off target data available for this crispr