ID: 939129514

View in Genome Browser
Species Human (GRCh38)
Location 2:138217530-138217552
Sequence TATATGTGTGTGGAGGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939129514_939129518 -8 Left 939129514 2:138217530-138217552 CCACTGCCCTCCACACACATATA No data
Right 939129518 2:138217545-138217567 CACATATATCATTACCAGTGAGG No data
939129514_939129521 24 Left 939129514 2:138217530-138217552 CCACTGCCCTCCACACACATATA No data
Right 939129521 2:138217577-138217599 AGTTAAACTCTGAGGACATTTGG No data
939129514_939129520 16 Left 939129514 2:138217530-138217552 CCACTGCCCTCCACACACATATA No data
Right 939129520 2:138217569-138217591 TAAAGAATAGTTAAACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939129514 Original CRISPR TATATGTGTGTGGAGGGCAG TGG (reversed) Intergenic
No off target data available for this crispr