ID: 939129515

View in Genome Browser
Species Human (GRCh38)
Location 2:138217536-138217558
Sequence TAATGATATATGTGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939129515_939129521 18 Left 939129515 2:138217536-138217558 CCCTCCACACACATATATCATTA No data
Right 939129521 2:138217577-138217599 AGTTAAACTCTGAGGACATTTGG No data
939129515_939129520 10 Left 939129515 2:138217536-138217558 CCCTCCACACACATATATCATTA No data
Right 939129520 2:138217569-138217591 TAAAGAATAGTTAAACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939129515 Original CRISPR TAATGATATATGTGTGTGGA GGG (reversed) Intergenic
No off target data available for this crispr