ID: 939129516

View in Genome Browser
Species Human (GRCh38)
Location 2:138217537-138217559
Sequence GTAATGATATATGTGTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939129516_939129520 9 Left 939129516 2:138217537-138217559 CCTCCACACACATATATCATTAC No data
Right 939129520 2:138217569-138217591 TAAAGAATAGTTAAACTCTGAGG No data
939129516_939129521 17 Left 939129516 2:138217537-138217559 CCTCCACACACATATATCATTAC No data
Right 939129521 2:138217577-138217599 AGTTAAACTCTGAGGACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939129516 Original CRISPR GTAATGATATATGTGTGTGG AGG (reversed) Intergenic
No off target data available for this crispr