ID: 939129518

View in Genome Browser
Species Human (GRCh38)
Location 2:138217545-138217567
Sequence CACATATATCATTACCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939129514_939129518 -8 Left 939129514 2:138217530-138217552 CCACTGCCCTCCACACACATATA No data
Right 939129518 2:138217545-138217567 CACATATATCATTACCAGTGAGG No data
939129513_939129518 -7 Left 939129513 2:138217529-138217551 CCCACTGCCCTCCACACACATAT No data
Right 939129518 2:138217545-138217567 CACATATATCATTACCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939129518 Original CRISPR CACATATATCATTACCAGTG AGG Intergenic
No off target data available for this crispr