ID: 939129521

View in Genome Browser
Species Human (GRCh38)
Location 2:138217577-138217599
Sequence AGTTAAACTCTGAGGACATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939129519_939129521 -5 Left 939129519 2:138217559-138217581 CCAGTGAGGCTAAAGAATAGTTA No data
Right 939129521 2:138217577-138217599 AGTTAAACTCTGAGGACATTTGG No data
939129514_939129521 24 Left 939129514 2:138217530-138217552 CCACTGCCCTCCACACACATATA No data
Right 939129521 2:138217577-138217599 AGTTAAACTCTGAGGACATTTGG No data
939129513_939129521 25 Left 939129513 2:138217529-138217551 CCCACTGCCCTCCACACACATAT No data
Right 939129521 2:138217577-138217599 AGTTAAACTCTGAGGACATTTGG No data
939129516_939129521 17 Left 939129516 2:138217537-138217559 CCTCCACACACATATATCATTAC No data
Right 939129521 2:138217577-138217599 AGTTAAACTCTGAGGACATTTGG No data
939129515_939129521 18 Left 939129515 2:138217536-138217558 CCCTCCACACACATATATCATTA No data
Right 939129521 2:138217577-138217599 AGTTAAACTCTGAGGACATTTGG No data
939129517_939129521 14 Left 939129517 2:138217540-138217562 CCACACACATATATCATTACCAG No data
Right 939129521 2:138217577-138217599 AGTTAAACTCTGAGGACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939129521 Original CRISPR AGTTAAACTCTGAGGACATT TGG Intergenic
No off target data available for this crispr