ID: 939132249

View in Genome Browser
Species Human (GRCh38)
Location 2:138250263-138250285
Sequence ACCATGCTAAAGTTTCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939132246_939132249 -2 Left 939132246 2:138250242-138250264 CCTGAGTGAACTTCCCTCATTAC No data
Right 939132249 2:138250263-138250285 ACCATGCTAAAGTTTCCAAGTGG No data
939132244_939132249 27 Left 939132244 2:138250213-138250235 CCTGACAGACCTAGCAACTTATA No data
Right 939132249 2:138250263-138250285 ACCATGCTAAAGTTTCCAAGTGG No data
939132245_939132249 18 Left 939132245 2:138250222-138250244 CCTAGCAACTTATAGATGAGCCT No data
Right 939132249 2:138250263-138250285 ACCATGCTAAAGTTTCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939132249 Original CRISPR ACCATGCTAAAGTTTCCAAG TGG Intergenic