ID: 939132249 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:138250263-138250285 |
Sequence | ACCATGCTAAAGTTTCCAAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
939132246_939132249 | -2 | Left | 939132246 | 2:138250242-138250264 | CCTGAGTGAACTTCCCTCATTAC | No data | ||
Right | 939132249 | 2:138250263-138250285 | ACCATGCTAAAGTTTCCAAGTGG | No data | ||||
939132244_939132249 | 27 | Left | 939132244 | 2:138250213-138250235 | CCTGACAGACCTAGCAACTTATA | No data | ||
Right | 939132249 | 2:138250263-138250285 | ACCATGCTAAAGTTTCCAAGTGG | No data | ||||
939132245_939132249 | 18 | Left | 939132245 | 2:138250222-138250244 | CCTAGCAACTTATAGATGAGCCT | No data | ||
Right | 939132249 | 2:138250263-138250285 | ACCATGCTAAAGTTTCCAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
939132249 | Original CRISPR | ACCATGCTAAAGTTTCCAAG TGG | Intergenic | ||