ID: 939134070

View in Genome Browser
Species Human (GRCh38)
Location 2:138273423-138273445
Sequence CGCCCATTGCTGCTCCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939134070_939134077 23 Left 939134070 2:138273423-138273445 CCAGTCAGGAGCAGCAATGGGCG No data
Right 939134077 2:138273469-138273491 GACACCCTGCTGGATCCAGAGGG No data
939134070_939134079 27 Left 939134070 2:138273423-138273445 CCAGTCAGGAGCAGCAATGGGCG No data
Right 939134079 2:138273473-138273495 CCCTGCTGGATCCAGAGGGATGG No data
939134070_939134075 13 Left 939134070 2:138273423-138273445 CCAGTCAGGAGCAGCAATGGGCG No data
Right 939134075 2:138273459-138273481 GAGCACAGCAGACACCCTGCTGG 0: 41
1: 94
2: 93
3: 75
4: 270
939134070_939134076 22 Left 939134070 2:138273423-138273445 CCAGTCAGGAGCAGCAATGGGCG No data
Right 939134076 2:138273468-138273490 AGACACCCTGCTGGATCCAGAGG No data
939134070_939134072 -9 Left 939134070 2:138273423-138273445 CCAGTCAGGAGCAGCAATGGGCG No data
Right 939134072 2:138273437-138273459 CAATGGGCGCCTCCTGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939134070 Original CRISPR CGCCCATTGCTGCTCCTGAC TGG (reversed) Intergenic
No off target data available for this crispr