ID: 939135841

View in Genome Browser
Species Human (GRCh38)
Location 2:138292083-138292105
Sequence ATGGCCTAAGAGAACTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939135841_939135846 12 Left 939135841 2:138292083-138292105 CCCTCTCAGTTCTCTTAGGCCAT No data
Right 939135846 2:138292118-138292140 GGTCTTTACCCTAAATCAGTGGG No data
939135841_939135845 11 Left 939135841 2:138292083-138292105 CCCTCTCAGTTCTCTTAGGCCAT No data
Right 939135845 2:138292117-138292139 TGGTCTTTACCCTAAATCAGTGG No data
939135841_939135843 -9 Left 939135841 2:138292083-138292105 CCCTCTCAGTTCTCTTAGGCCAT No data
Right 939135843 2:138292097-138292119 TTAGGCCATACTAAGAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939135841 Original CRISPR ATGGCCTAAGAGAACTGAGA GGG (reversed) Intergenic
No off target data available for this crispr