ID: 939137019

View in Genome Browser
Species Human (GRCh38)
Location 2:138308856-138308878
Sequence GTAGGACAGTGGTTCTCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939137019_939137025 22 Left 939137019 2:138308856-138308878 CCAACTGAGAACCACTGTCCTAC No data
Right 939137025 2:138308901-138308923 GAAAAAAATAACAATGACAAAGG No data
939137019_939137024 -2 Left 939137019 2:138308856-138308878 CCAACTGAGAACCACTGTCCTAC No data
Right 939137024 2:138308877-138308899 ACAGAGCAGGCAATATTGCAGGG No data
939137019_939137023 -3 Left 939137019 2:138308856-138308878 CCAACTGAGAACCACTGTCCTAC No data
Right 939137023 2:138308876-138308898 TACAGAGCAGGCAATATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939137019 Original CRISPR GTAGGACAGTGGTTCTCAGT TGG (reversed) Intergenic
No off target data available for this crispr