ID: 939141787

View in Genome Browser
Species Human (GRCh38)
Location 2:138362624-138362646
Sequence AACGGTAGACAGAAGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939141784_939141787 -7 Left 939141784 2:138362608-138362630 CCAAAGTAGAAAGATAAACGGTA No data
Right 939141787 2:138362624-138362646 AACGGTAGACAGAAGAAGGAGGG No data
939141783_939141787 -6 Left 939141783 2:138362607-138362629 CCCAAAGTAGAAAGATAAACGGT No data
Right 939141787 2:138362624-138362646 AACGGTAGACAGAAGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939141787 Original CRISPR AACGGTAGACAGAAGAAGGA GGG Intergenic
No off target data available for this crispr