ID: 939141850

View in Genome Browser
Species Human (GRCh38)
Location 2:138363432-138363454
Sequence GCCAAATAAACAATAATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939141849_939141850 12 Left 939141849 2:138363397-138363419 CCGTGATTTATCTAGCACTGGTC No data
Right 939141850 2:138363432-138363454 GCCAAATAAACAATAATGAAAGG No data
939141847_939141850 22 Left 939141847 2:138363387-138363409 CCTTTCTATTCCGTGATTTATCT No data
Right 939141850 2:138363432-138363454 GCCAAATAAACAATAATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939141850 Original CRISPR GCCAAATAAACAATAATGAA AGG Intergenic
No off target data available for this crispr